Incidental Mutation 'R5201:Fzr1'
ID400807
Institutional Source Beutler Lab
Gene Symbol Fzr1
Ensembl Gene ENSMUSG00000020235
Gene Namefizzy and cell division cycle 20 related 1
SynonymsCdh1, Fyr
MMRRC Submission 042776-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5201 (G1)
Quality Score158
Status Not validated
Chromosome10
Chromosomal Location81366222-81378516 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 81367528 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 399 (L399H)
Ref Sequence ENSEMBL: ENSMUSP00000112868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020456] [ENSMUST00000020457] [ENSMUST00000044844] [ENSMUST00000118812] [ENSMUST00000140901]
Predicted Effect probably benign
Transcript: ENSMUST00000020456
SMART Domains Protein: ENSMUSP00000020456
Gene: ENSMUSG00000020234

DomainStartEndE-ValueType
Pfam:DUF4531 23 204 1.3e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000020457
SMART Domains Protein: ENSMUSP00000020457
Gene: ENSMUSG00000020235

DomainStartEndE-ValueType
Blast:WD40 172 213 8e-21 BLAST
WD40 218 257 1.2e-2 SMART
WD40 260 297 6.79e-2 SMART
WD40 302 341 3.55e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000044844
SMART Domains Protein: ENSMUSP00000036116
Gene: ENSMUSG00000034854

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Pfam:MFS_2 20 423 5.2e-43 PFAM
Pfam:MFS_1 154 416 6.8e-12 PFAM
transmembrane domain 441 463 N/A INTRINSIC
low complexity region 464 476 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118812
AA Change: L399H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112868
Gene: ENSMUSG00000020235
AA Change: L399H

DomainStartEndE-ValueType
WD40 129 168 5.6e-3 SMART
WD40 171 208 6.79e-2 SMART
WD40 213 252 3.99e-8 SMART
WD40 255 297 2.84e-4 SMART
WD40 300 340 1.98e1 SMART
WD40 343 382 1.11e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130762
Predicted Effect probably benign
Transcript: ENSMUST00000131736
SMART Domains Protein: ENSMUSP00000123068
Gene: ENSMUSG00000020234

DomainStartEndE-ValueType
Pfam:DUF4531 1 128 2.6e-47 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138343
Predicted Effect possibly damaging
Transcript: ENSMUST00000140901
AA Change: L488H

PolyPhen 2 Score 0.519 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000114203
Gene: ENSMUSG00000020235
AA Change: L488H

DomainStartEndE-ValueType
Blast:WD40 172 213 1e-19 BLAST
WD40 218 257 1.2e-2 SMART
WD40 260 297 6.79e-2 SMART
WD40 302 341 3.99e-8 SMART
WD40 344 386 2.84e-4 SMART
WD40 389 429 1.98e1 SMART
WD40 432 471 1.11e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150824
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mutants die embryonically at around E9.5-E12.5 with poorly developed placentae, no placental giant cells and/or erythroblast deficiency. Homozygous MEFs undergo premature senescence. Heterozygotes exhibit learning/memory defects and/or elevatedspontaneous epithelial tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930407I10Rik C A 15: 82,062,544 T214N probably benign Het
Actn4 A T 7: 28,916,255 probably null Het
Arap2 T C 5: 62,683,489 E678G probably damaging Het
Atl2 T C 17: 79,865,151 N130S probably benign Het
Ccdc129 T C 6: 55,968,006 S571P probably benign Het
Cyp2b10 A G 7: 25,916,994 D342G probably damaging Het
Dnah6 A G 6: 73,195,732 Y248H possibly damaging Het
Drd5 A T 5: 38,320,023 M120L probably damaging Het
Duox1 A G 2: 122,327,922 R629G probably benign Het
Dyrk1b A G 7: 28,185,096 Y279C probably damaging Het
Efemp1 A T 11: 28,914,590 I215L probably benign Het
Enpp6 C A 8: 47,065,451 Q205K probably damaging Het
Fam170a A T 18: 50,282,126 T280S probably benign Het
Fam222a G A 5: 114,611,066 A108T possibly damaging Het
Fgd3 G T 13: 49,296,378 P132T probably benign Het
Galnt15 G A 14: 32,049,865 R289Q probably damaging Het
Hira T C 16: 18,952,115 V834A probably damaging Het
Ilf3 T C 9: 21,389,383 L93P probably damaging Het
Itgae G A 11: 73,110,556 R71Q probably benign Het
Kif14 T A 1: 136,503,407 S1181T probably benign Het
Lrig3 C A 10: 126,013,151 P946Q possibly damaging Het
Macf1 A T 4: 123,475,945 C1674* probably null Het
Malt1 A G 18: 65,476,055 K710R probably benign Het
Man1a2 A T 3: 100,617,012 N373K probably benign Het
Mkl2 A C 16: 13,401,592 T701P probably benign Het
Mpped2 A G 2: 106,699,502 N32S possibly damaging Het
Myh10 A T 11: 68,783,195 T652S probably damaging Het
Nfia A G 4: 98,111,225 Y485C probably damaging Het
Olfml2b A T 1: 170,668,864 T355S probably benign Het
Olfr1419 A T 19: 11,870,631 I195K probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Pcdh1 A T 18: 38,198,918 V344D probably damaging Het
Plekhn1 C A 4: 156,230,527 V558L probably benign Het
Prr14l A G 5: 32,830,247 S635P possibly damaging Het
Prss46 T A 9: 110,851,475 C229* probably null Het
Rad50 A G 11: 53,698,820 probably null Het
Slc27a3 A T 3: 90,389,219 L191Q probably benign Het
Spert A G 14: 75,584,009 V101A probably damaging Het
Surf4 A G 2: 26,933,766 probably benign Het
Taf3 A G 2: 9,952,184 S391P probably damaging Het
Tep1 A C 14: 50,868,110 L151R probably benign Het
Tmprss11d A C 5: 86,309,355 N148K possibly damaging Het
Tpd52l2 G A 2: 181,515,086 V172I probably benign Het
Vmn2r77 A G 7: 86,811,638 D724G probably damaging Het
Wdr75 T A 1: 45,823,359 D779E probably benign Het
Zfp943 A T 17: 21,992,813 K293N probably damaging Het
Other mutations in Fzr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Fzr1 APN 10 81370525 nonsense probably null
IGL02541:Fzr1 APN 10 81370033 missense probably damaging 0.98
IGL03327:Fzr1 APN 10 81369184 missense probably benign 0.05
IGL03346:Fzr1 APN 10 81369184 missense probably benign 0.05
PIT4445001:Fzr1 UTSW 10 81369394 nonsense probably null
R0179:Fzr1 UTSW 10 81369070 splice site probably benign
R0403:Fzr1 UTSW 10 81369368 missense possibly damaging 0.95
R1591:Fzr1 UTSW 10 81370367 missense possibly damaging 0.75
R1987:Fzr1 UTSW 10 81370319 missense probably damaging 0.98
R2358:Fzr1 UTSW 10 81367640 critical splice donor site probably null
R2844:Fzr1 UTSW 10 81369418 missense probably damaging 1.00
R4657:Fzr1 UTSW 10 81367552 critical splice acceptor site probably null
R5054:Fzr1 UTSW 10 81371419 utr 5 prime probably benign
R5108:Fzr1 UTSW 10 81369450 splice site probably benign
R5494:Fzr1 UTSW 10 81371344 critical splice donor site probably null
R5663:Fzr1 UTSW 10 81370526 missense probably benign 0.00
R5733:Fzr1 UTSW 10 81370326 missense possibly damaging 0.95
R5997:Fzr1 UTSW 10 81370826 critical splice acceptor site probably null
R6777:Fzr1 UTSW 10 81370493 missense probably damaging 1.00
R7055:Fzr1 UTSW 10 81370223 missense probably damaging 1.00
R7078:Fzr1 UTSW 10 81368629 missense probably damaging 1.00
R7883:Fzr1 UTSW 10 81368635 missense probably damaging 1.00
R7966:Fzr1 UTSW 10 81368635 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCACAGCTCACAATGAGGC -3'
(R):5'- GAAATAGCCAGGTCCTTCTGCC -3'

Sequencing Primer
(F):5'- CAATGAGGCATTTAATGAGACTCTGG -3'
(R):5'- TATAGGCCATGTCCCCTGATGG -3'
Posted On2016-07-06