Mutagenetix > Incidental Mutations

Incidental Mutation 'R7345:Zfat'

570165

Institutional Source

Beutler Lab

Gene Symbol

Zfat

Ensembl Gene

ENSMUSG00000022335

Gene Name

zinc finger and AT hook domain containing

Synonyms

LOC380993, Zfat1, Zfp406

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7345 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

68083764-68258856 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 68105043 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 1086 (Y1086N)

Ref Sequence

ENSEMBL: ENSMUSP00000125257 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000160248] [ENSMUST00000162054] [ENSMUST00000162173]

AlphaFold

Q7TS63

Predicted Effect

probably damaging
Transcript: ENSMUST00000160248
AA Change: Y1086N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000125257
Gene: ENSMUSG00000022335
AA Change: Y1086N

Domain	Start	End	E-Value	Type
ZnF_C2H2	12	35	2.45e0	SMART
ZnF_C2H2	116	136	1.53e2	SMART
low complexity region	220	236	N/A	INTRINSIC
ZnF_C2H2	271	293	1.47e-3	SMART
ZnF_C2H2	299	321	1.18e-2	SMART
ZnF_C2H2	326	349	2.36e-2	SMART
ZnF_C2H2	354	377	4.4e-2	SMART
ZnF_C2H2	404	426	1.67e-2	SMART
ZnF_C2H2	432	454	1.33e-1	SMART
ZnF_C2H2	458	481	2.05e-2	SMART
low complexity region	601	617	N/A	INTRINSIC
ZnF_C2H2	737	759	1.43e-1	SMART
ZnF_C2H2	765	788	3.52e-1	SMART
ZnF_C2H2	793	817	5.59e-4	SMART
ZnF_C2H2	825	848	3.83e-2	SMART
ZnF_C2H2	875	898	3.95e1	SMART
ZnF_C2H2	904	926	6.88e-4	SMART
ZnF_C2H2	932	954	8.94e-3	SMART
ZnF_C2H2	961	983	2.27e-4	SMART
ZnF_C2H2	989	1012	9.3e-1	SMART
ZnF_C2H2	1036	1059	5.21e-4	SMART
low complexity region	1073	1082	N/A	INTRINSIC
low complexity region	1139	1149	N/A	INTRINSIC
low complexity region	1218	1236	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000162054
AA Change: Y1068N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125732
Gene: ENSMUSG00000022335
AA Change: Y1068N

Domain	Start	End	E-Value	Type
ZnF_C2H2	12	35	2.45e0	SMART
ZnF_C2H2	116	136	1.53e2	SMART
low complexity region	213	229	N/A	INTRINSIC
ZnF_C2H2	264	286	1.47e-3	SMART
ZnF_C2H2	292	314	1.18e-2	SMART
ZnF_C2H2	319	342	2.36e-2	SMART
ZnF_C2H2	347	370	4.4e-2	SMART
ZnF_C2H2	397	419	1.67e-2	SMART
ZnF_C2H2	425	447	1.33e-1	SMART
ZnF_C2H2	451	474	2.05e-2	SMART
low complexity region	594	610	N/A	INTRINSIC
ZnF_C2H2	730	752	1.43e-1	SMART
ZnF_C2H2	758	781	3.52e-1	SMART
ZnF_C2H2	786	810	5.59e-4	SMART
ZnF_C2H2	818	841	3.83e-2	SMART
ZnF_C2H2	868	891	3.95e1	SMART
ZnF_C2H2	897	919	6.88e-4	SMART
ZnF_C2H2	925	947	8.94e-3	SMART
ZnF_C2H2	954	976	2.27e-4	SMART
ZnF_C2H2	982	1005	9.3e-1	SMART
ZnF_C2H2	1029	1052	5.21e-4	SMART
low complexity region	1121	1131	N/A	INTRINSIC
low complexity region	1200	1218	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000162173

SMART Domains

Protein: ENSMUSP00000124974
Gene: ENSMUSG00000022335

Domain	Start	End	E-Value	Type
ZnF_C2H2	12	35	2.45e0	SMART
ZnF_C2H2	116	136	1.53e2	SMART
low complexity region	220	236	N/A	INTRINSIC
ZnF_C2H2	271	293	1.47e-3	SMART
ZnF_C2H2	299	321	1.18e-2	SMART
ZnF_C2H2	326	349	2.36e-2	SMART
ZnF_C2H2	354	377	4.4e-2	SMART
ZnF_C2H2	404	426	1.67e-2	SMART
ZnF_C2H2	432	454	1.33e-1	SMART
ZnF_C2H2	458	481	2.05e-2	SMART
low complexity region	601	617	N/A	INTRINSIC
ZnF_C2H2	737	759	1.43e-1	SMART
ZnF_C2H2	765	788	3.52e-1	SMART
ZnF_C2H2	793	817	5.59e-4	SMART
ZnF_C2H2	825	848	3.83e-2	SMART
ZnF_C2H2	875	898	3.95e1	SMART
ZnF_C2H2	904	926	6.88e-4	SMART
ZnF_C2H2	932	954	8.94e-3	SMART
ZnF_C2H2	961	983	2.27e-4	SMART
ZnF_C2H2	989	1012	9.3e-1	SMART
ZnF_C2H2	1036	1059	5.21e-4	SMART
low complexity region	1133	1151	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (55/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely binds DNA and functions as a transcriptional regulator involved in apoptosis and cell survival. This gene resides in a susceptibility locus for autoimmune thyroid disease (AITD) on chromosome 8q24. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality associated with failure to initiation of embryo turning, abnormal embryonic hematopoiesis, abnormal spongiotrophoblast layer morphology, abnormal visceral yolk sac blood island morphology and pale yolk sac. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Anks3	A	G	16: 4,955,910	M174T	possibly damaging	Het
Arhgap23	G	A	11: 97,466,478	R934Q	possibly damaging	Het
Atad5	T	C	11: 80,096,006	S640P	probably damaging	Het
B3galnt2	C	T	13: 13,980,480		probably null	Het
B430305J03Rik	T	C	3: 61,364,118	S69G	unknown	Het
C87499	T	C	4: 88,628,179	K309E	possibly damaging	Het
Cd163	A	T	6: 124,318,938	N747I	possibly damaging	Het
Cep126	A	G	9: 8,099,816	S906P	probably damaging	Het
Cyp4f39	G	A	17: 32,486,779	G318R	probably damaging	Het
D630003M21Rik	C	T	2: 158,217,209	G257D	probably damaging	Het
Dcaf10	T	C	4: 45,342,583	L139P	probably damaging	Het
Dcc	A	G	18: 71,378,824	V840A	probably benign	Het
Dnhd1	A	T	7: 105,703,967	I2776L	probably benign	Het
Fam166b	T	C	4: 43,428,022	D145G	possibly damaging	Het
Fbxo24	G	T	5: 137,621,261	F234L	probably damaging	Het
Gm21190	T	C	5: 15,527,904		probably null	Het
Grhl3	C	T	4: 135,546,246	R565Q	probably damaging	Het
Gtf3c1	A	T	7: 125,645,670	Y1731N	probably damaging	Het
Il1a	C	A	2: 129,304,773	R133S	probably benign	Het
Ipo4	C	T	14: 55,635,531	R23Q	probably benign	Het
Klc3	G	A	7: 19,394,889	T481M	probably benign	Het
Map2k6	A	T	11: 110,492,908	I127F		Het
Mapk8	A	T	14: 33,408,111	N63K	probably damaging	Het
Med13l	T	C	5: 118,742,760	W1306R	probably damaging	Het
Megf6	C	A	4: 154,267,315	Q1162K	probably benign	Het
Myo5b	A	G	18: 74,708,024	E992G	possibly damaging	Het
Ndst4	C	T	3: 125,714,659	T291M	probably benign	Het
Nek10	T	A	14: 14,955,503	F838L	probably benign	Het
Nrm	A	G	17: 35,864,584	H194R	probably damaging	Het
Nup188	T	C	2: 30,340,601	S1384P	probably benign	Het
Olfml2a	C	A	2: 38,960,127	D618E	probably damaging	Het
Olfr466	A	C	13: 65,152,743	N173T	possibly damaging	Het
Olfr506	C	T	7: 108,613,063	T252I	probably benign	Het
Olfr937	A	G	9: 39,060,579	L29P	probably damaging	Het
Olfr938	G	A	9: 39,078,334	S137F	probably damaging	Het
P2ry1	T	C	3: 61,003,674	F78S	possibly damaging	Het
Pcdhb18	T	C	18: 37,491,923	F769L	probably benign	Het
Poc5	A	G	13: 96,396,796	E144G	probably damaging	Het
Pole	T	A	5: 110,303,903	N870K	possibly damaging	Het
Polr2b	T	C	5: 77,349,119	F1159L	possibly damaging	Het
Rubcnl	A	G	14: 75,042,353	Y392C	probably benign	Het
Sec31a	T	C	5: 100,385,270	T539A	probably damaging	Het
Serpinh1	A	C	7: 99,346,356	S340A	probably damaging	Het
Slc1a5	T	A	7: 16,796,160		probably null	Het
Soat2	A	G	15: 102,162,578	D469G	probably benign	Het
Speg	T	C	1: 75,384,835	L70P	probably damaging	Het
Spred2	T	C	11: 19,924,958		probably null	Het
Stac2	A	C	11: 98,042,613	S168A	probably damaging	Het
Stx1a	T	A	5: 135,037,188	D31E	probably benign	Het
Timeless	C	T	10: 128,249,754	T885M	probably damaging	Het
Tmem94	G	T	11: 115,786,256	R118L	possibly damaging	Het
Tsen34	T	C	7: 3,695,615	Y253H	probably damaging	Het
Unc13b	T	C	4: 43,173,966	V1598A	unknown	Het
Zfp551	G	A	7: 12,416,595	H296Y	probably benign	Het

Other mutations in Zfat

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00542:Zfat	APN	15	68170222	missense	possibly damaging	0.92
IGL00862:Zfat	APN	15	68258663	splice site	probably null
IGL01021:Zfat	APN	15	68170166	missense	possibly damaging	0.50
IGL01152:Zfat	APN	15	68110504	missense	probably damaging	1.00
IGL01733:Zfat	APN	15	68180730	missense	probably damaging	1.00
IGL01873:Zfat	APN	15	68224895	missense	probably benign	0.00
IGL01990:Zfat	APN	15	68224817	missense	probably damaging	1.00
IGL02066:Zfat	APN	15	68180829	missense	probably damaging	1.00
IGL02664:Zfat	APN	15	68180721	missense	probably damaging	1.00
IGL02955:Zfat	APN	15	68181114	missense	probably damaging	0.98
IGL03201:Zfat	APN	15	68165909	missense	probably damaging	1.00
R0145:Zfat	UTSW	15	68187099	missense	possibly damaging	0.95
R0408:Zfat	UTSW	15	68180292	missense	probably benign	0.10
R0633:Zfat	UTSW	15	68180803	missense	probably damaging	1.00
R1147:Zfat	UTSW	15	68212583	splice site	probably benign
R1508:Zfat	UTSW	15	68178751	missense	probably damaging	1.00
R1513:Zfat	UTSW	15	68212680	missense	probably damaging	1.00
R1641:Zfat	UTSW	15	68180110	missense	probably benign	0.19
R1889:Zfat	UTSW	15	68101539	missense	probably benign	0.00
R1959:Zfat	UTSW	15	68146543	missense	probably benign	0.32
R2030:Zfat	UTSW	15	68118934	critical splice donor site	probably null
R2202:Zfat	UTSW	15	68179860	missense	probably benign	0.36
R2340:Zfat	UTSW	15	68101541	missense	probably damaging	0.99
R3440:Zfat	UTSW	15	68084553	missense	probably benign	0.00
R3442:Zfat	UTSW	15	68084553	missense	probably benign	0.00
R3442:Zfat	UTSW	15	68101581	missense	probably damaging	0.99
R4406:Zfat	UTSW	15	68180191	missense	probably benign	0.00
R4649:Zfat	UTSW	15	68184476	missense	probably damaging	1.00
R4710:Zfat	UTSW	15	68180282	missense	probably benign
R4712:Zfat	UTSW	15	68110475	critical splice donor site	probably null
R4745:Zfat	UTSW	15	68180374	missense	probably benign	0.09
R4862:Zfat	UTSW	15	68180110	missense	probably benign	0.02
R5015:Zfat	UTSW	15	68178913	missense	probably damaging	1.00
R5075:Zfat	UTSW	15	68180230	missense	probably benign
R5208:Zfat	UTSW	15	68180721	missense	probably damaging	1.00
R5277:Zfat	UTSW	15	68165909	missense	probably damaging	1.00
R5303:Zfat	UTSW	15	68110486	missense	probably damaging	1.00
R5328:Zfat	UTSW	15	68179828	missense	probably damaging	0.99
R5642:Zfat	UTSW	15	68180916	missense	probably damaging	1.00
R5659:Zfat	UTSW	15	68119013	missense	probably damaging	1.00
R5947:Zfat	UTSW	15	68179957	missense	probably benign
R6046:Zfat	UTSW	15	68180777	missense	probably damaging	0.99
R6315:Zfat	UTSW	15	68084462	missense	probably damaging	1.00
R6342:Zfat	UTSW	15	68180982	missense	probably damaging	1.00
R6573:Zfat	UTSW	15	68165854	missense	probably damaging	1.00
R6789:Zfat	UTSW	15	68084386	missense	probably damaging	1.00
R7028:Zfat	UTSW	15	68180452	missense	probably damaging	1.00
R7033:Zfat	UTSW	15	68181015	missense	probably damaging	1.00
R7039:Zfat	UTSW	15	68180362	missense	probably benign
R7065:Zfat	UTSW	15	68181120	missense	probably damaging	1.00
R7144:Zfat	UTSW	15	68178782	missense	probably benign	0.12
R7208:Zfat	UTSW	15	68180007	missense	probably benign	0.39
R7330:Zfat	UTSW	15	68212751	missense	probably benign	0.00
R7378:Zfat	UTSW	15	68181120	missense	probably damaging	1.00
R7405:Zfat	UTSW	15	68184485	missense	probably damaging	1.00
R7481:Zfat	UTSW	15	68178866	nonsense	probably null
R7672:Zfat	UTSW	15	68258686	start codon destroyed	probably null	0.39
R7676:Zfat	UTSW	15	68224844	missense	possibly damaging	0.88
R7701:Zfat	UTSW	15	68180908	nonsense	probably null
R7825:Zfat	UTSW	15	68179920	missense	probably benign	0.01
R8152:Zfat	UTSW	15	68101506	missense	probably benign	0.23
R8404:Zfat	UTSW	15	68105067	missense	probably benign	0.00
R8405:Zfat	UTSW	15	68146561	missense	probably damaging	1.00
R8502:Zfat	UTSW	15	68105067	missense	probably benign	0.00
R8534:Zfat	UTSW	15	68165847	missense	probably damaging	1.00
R8708:Zfat	UTSW	15	68084429	missense	possibly damaging	0.95
R8887:Zfat	UTSW	15	68184466	missense	probably damaging	1.00
R8896:Zfat	UTSW	15	68180670	missense	probably damaging	1.00
R8906:Zfat	UTSW	15	68084555	missense	possibly damaging	0.81
R9117:Zfat	UTSW	15	68187069	missense	probably damaging	0.98
R9137:Zfat	UTSW	15	68179945	missense	probably benign	0.00
R9310:Zfat	UTSW	15	68084401	missense	probably damaging	1.00
Z1088:Zfat	UTSW	15	68187101	missense	probably benign	0.00
Z1177:Zfat	UTSW	15	68179828	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTAGGGGATTTTCAGATGGGAAACTAG -3'
(R):5'- TGTTATCTTTGGGCAATGCATC -3'

Sequencing Primer
(F):5'- TTTTCAGATGGGAAACTAGGAAAGG -3'
(R):5'- GGCAATGCATCTGTTAGAGC -3'

Posted On

2019-09-13