Mutagenetix > Incidental Mutations

Incidental Mutation 'R5277:Zfat'

404019

Institutional Source

Beutler Lab

Gene Symbol

Zfat

Ensembl Gene

ENSMUSG00000022335

Gene Name

zinc finger and AT hook domain containing

Synonyms

LOC380993, Zfat1, Zfp406

MMRRC Submission

042864-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5277 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

68083764-68258856 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 68165909 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Arginine at position 906 (C906R)

Ref Sequence

ENSEMBL: ENSMUSP00000124974 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000160248] [ENSMUST00000162054] [ENSMUST00000162173]

Predicted Effect

probably damaging
Transcript: ENSMUST00000160248
AA Change: C906R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125257
Gene: ENSMUSG00000022335
AA Change: C906R

Domain	Start	End	E-Value	Type
ZnF_C2H2	12	35	2.45e0	SMART
ZnF_C2H2	116	136	1.53e2	SMART
low complexity region	220	236	N/A	INTRINSIC
ZnF_C2H2	271	293	1.47e-3	SMART
ZnF_C2H2	299	321	1.18e-2	SMART
ZnF_C2H2	326	349	2.36e-2	SMART
ZnF_C2H2	354	377	4.4e-2	SMART
ZnF_C2H2	404	426	1.67e-2	SMART
ZnF_C2H2	432	454	1.33e-1	SMART
ZnF_C2H2	458	481	2.05e-2	SMART
low complexity region	601	617	N/A	INTRINSIC
ZnF_C2H2	737	759	1.43e-1	SMART
ZnF_C2H2	765	788	3.52e-1	SMART
ZnF_C2H2	793	817	5.59e-4	SMART
ZnF_C2H2	825	848	3.83e-2	SMART
ZnF_C2H2	875	898	3.95e1	SMART
ZnF_C2H2	904	926	6.88e-4	SMART
ZnF_C2H2	932	954	8.94e-3	SMART
ZnF_C2H2	961	983	2.27e-4	SMART
ZnF_C2H2	989	1012	9.3e-1	SMART
ZnF_C2H2	1036	1059	5.21e-4	SMART
low complexity region	1073	1082	N/A	INTRINSIC
low complexity region	1139	1149	N/A	INTRINSIC
low complexity region	1218	1236	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000162054
AA Change: C899R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000125732
Gene: ENSMUSG00000022335
AA Change: C899R

Domain	Start	End	E-Value	Type
ZnF_C2H2	12	35	2.45e0	SMART
ZnF_C2H2	116	136	1.53e2	SMART
low complexity region	213	229	N/A	INTRINSIC
ZnF_C2H2	264	286	1.47e-3	SMART
ZnF_C2H2	292	314	1.18e-2	SMART
ZnF_C2H2	319	342	2.36e-2	SMART
ZnF_C2H2	347	370	4.4e-2	SMART
ZnF_C2H2	397	419	1.67e-2	SMART
ZnF_C2H2	425	447	1.33e-1	SMART
ZnF_C2H2	451	474	2.05e-2	SMART
low complexity region	594	610	N/A	INTRINSIC
ZnF_C2H2	730	752	1.43e-1	SMART
ZnF_C2H2	758	781	3.52e-1	SMART
ZnF_C2H2	786	810	5.59e-4	SMART
ZnF_C2H2	818	841	3.83e-2	SMART
ZnF_C2H2	868	891	3.95e1	SMART
ZnF_C2H2	897	919	6.88e-4	SMART
ZnF_C2H2	925	947	8.94e-3	SMART
ZnF_C2H2	954	976	2.27e-4	SMART
ZnF_C2H2	982	1005	9.3e-1	SMART
ZnF_C2H2	1029	1052	5.21e-4	SMART
low complexity region	1121	1131	N/A	INTRINSIC
low complexity region	1200	1218	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000162173
AA Change: C906R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000124974
Gene: ENSMUSG00000022335
AA Change: C906R

Domain	Start	End	E-Value	Type
ZnF_C2H2	12	35	2.45e0	SMART
ZnF_C2H2	116	136	1.53e2	SMART
low complexity region	220	236	N/A	INTRINSIC
ZnF_C2H2	271	293	1.47e-3	SMART
ZnF_C2H2	299	321	1.18e-2	SMART
ZnF_C2H2	326	349	2.36e-2	SMART
ZnF_C2H2	354	377	4.4e-2	SMART
ZnF_C2H2	404	426	1.67e-2	SMART
ZnF_C2H2	432	454	1.33e-1	SMART
ZnF_C2H2	458	481	2.05e-2	SMART
low complexity region	601	617	N/A	INTRINSIC
ZnF_C2H2	737	759	1.43e-1	SMART
ZnF_C2H2	765	788	3.52e-1	SMART
ZnF_C2H2	793	817	5.59e-4	SMART
ZnF_C2H2	825	848	3.83e-2	SMART
ZnF_C2H2	875	898	3.95e1	SMART
ZnF_C2H2	904	926	6.88e-4	SMART
ZnF_C2H2	932	954	8.94e-3	SMART
ZnF_C2H2	961	983	2.27e-4	SMART
ZnF_C2H2	989	1012	9.3e-1	SMART
ZnF_C2H2	1036	1059	5.21e-4	SMART
low complexity region	1133	1151	N/A	INTRINSIC

Meta Mutation Damage Score

0.9674

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.9%

Validation Efficiency

98% (52/53)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that likely binds DNA and functions as a transcriptional regulator involved in apoptosis and cell survival. This gene resides in a susceptibility locus for autoimmune thyroid disease (AITD) on chromosome 8q24. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete embryonic lethality associated with failure to initiation of embryo turning, abnormal embryonic hematopoiesis, abnormal spongiotrophoblast layer morphology, abnormal visceral yolk sac blood island morphology and pale yolk sac. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 45 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abi1	T	C	2: 22,994,648	T54A	probably damaging	Het
Ablim1	T	C	19: 57,155,261	R89G	probably damaging	Het
Bco1	T	A	8: 117,117,389		probably null	Het
Bhmt	A	T	13: 93,624,885	M185K	possibly damaging	Het
Camk2d	T	C	3: 126,684,741		probably benign	Het
Cmtm1	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	8: 104,309,470		probably benign	Het
Dcaf6	A	G	1: 165,424,346	S70P	probably benign	Het
Dclre1a	C	T	19: 56,544,732	V477I	possibly damaging	Het
Dnah10	C	T	5: 124,828,137	P4021L	probably damaging	Het
Dusp10	A	G	1: 184,037,007	N57D	possibly damaging	Het
Fam13b	G	A	18: 34,462,190	R374C	probably benign	Het
Fyb2	G	A	4: 105,015,679	D686N	probably damaging	Het
Glra3	G	A	8: 55,991,207	M67I	possibly damaging	Het
Gm14325	G	A	2: 177,832,984	H102Y	possibly damaging	Het
Gm6180	A	G	8: 42,247,140		noncoding transcript	Het
Grin2c	A	G	11: 115,253,813	V629A	probably damaging	Het
Kif4-ps	A	T	12: 101,145,927		noncoding transcript	Het
Mc3r	T	C	2: 172,249,787	F310L	probably damaging	Het
Myh4	A	G	11: 67,252,354	D1036G	probably damaging	Het
Myh6	A	G	14: 54,956,562	I790T	probably benign	Het
Myo15	C	A	11: 60,477,114	Y233*	probably null	Het
Nckap5	A	T	1: 126,026,540	C758*	probably null	Het
Neurog3	T	A	10: 62,133,853	Y36N	probably damaging	Het
Nlrp4e	T	C	7: 23,321,438	L450P	probably benign	Het
Olfr607	A	T	7: 103,460,941	L84H	probably damaging	Het
Otog	A	G	7: 46,246,621	E170G	possibly damaging	Het
Ppp2r2b	G	T	18: 42,741,142	T41K	probably damaging	Het
Prmt5	A	T	14: 54,509,942	D459E	probably benign	Het
Ric8b	G	A	10: 84,947,652	V125M	probably damaging	Het
Rptor	A	G	11: 119,822,956	S4G	probably damaging	Het
Rslcan18	T	G	13: 67,098,434	E371D	probably benign	Het
Scaf11	A	T	15: 96,419,226	F819Y	probably damaging	Het
Sema6a	A	T	18: 47,276,544		probably benign	Het
Snx29	C	T	16: 11,399,824	T163I	possibly damaging	Het
Sphkap	T	C	1: 83,276,164	N1288S	probably benign	Het
Tmbim7	G	A	5: 3,673,192		probably null	Het
Tmem63c	T	A	12: 87,057,757		probably null	Het
Tmem69	A	G	4: 116,553,261	F171L	probably benign	Het
Urod	A	T	4: 116,990,285		probably benign	Het
Vmn1r37	A	T	6: 66,731,476	I29L	probably benign	Het
Vmn2r102	A	G	17: 19,694,131	T653A	possibly damaging	Het
Vmn2r75	A	C	7: 86,166,292	S121R	probably benign	Het
Vwde	T	C	6: 13,186,996	T831A	probably benign	Het
Wdr70	C	T	15: 7,976,984	W362*	probably null	Het
Zfp7	T	C	15: 76,881,203	V32A	probably damaging	Het

Other mutations in Zfat

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00542:Zfat	APN	15	68170222	missense	possibly damaging	0.92
IGL00862:Zfat	APN	15	68258663	splice site	probably null
IGL01021:Zfat	APN	15	68170166	missense	possibly damaging	0.50
IGL01152:Zfat	APN	15	68110504	missense	probably damaging	1.00
IGL01733:Zfat	APN	15	68180730	missense	probably damaging	1.00
IGL01873:Zfat	APN	15	68224895	missense	probably benign	0.00
IGL01990:Zfat	APN	15	68224817	missense	probably damaging	1.00
IGL02066:Zfat	APN	15	68180829	missense	probably damaging	1.00
IGL02664:Zfat	APN	15	68180721	missense	probably damaging	1.00
IGL02955:Zfat	APN	15	68181114	missense	probably damaging	0.98
IGL03201:Zfat	APN	15	68165909	missense	probably damaging	1.00
R0145:Zfat	UTSW	15	68187099	missense	possibly damaging	0.95
R0408:Zfat	UTSW	15	68180292	missense	probably benign	0.10
R0633:Zfat	UTSW	15	68180803	missense	probably damaging	1.00
R1147:Zfat	UTSW	15	68212583	splice site	probably benign
R1508:Zfat	UTSW	15	68178751	missense	probably damaging	1.00
R1513:Zfat	UTSW	15	68212680	missense	probably damaging	1.00
R1641:Zfat	UTSW	15	68180110	missense	probably benign	0.19
R1889:Zfat	UTSW	15	68101539	missense	probably benign	0.00
R1959:Zfat	UTSW	15	68146543	missense	probably benign	0.32
R2030:Zfat	UTSW	15	68118934	critical splice donor site	probably null
R2202:Zfat	UTSW	15	68179860	missense	probably benign	0.36
R2340:Zfat	UTSW	15	68101541	missense	probably damaging	0.99
R3440:Zfat	UTSW	15	68084553	missense	probably benign	0.00
R3442:Zfat	UTSW	15	68084553	missense	probably benign	0.00
R3442:Zfat	UTSW	15	68101581	missense	probably damaging	0.99
R4406:Zfat	UTSW	15	68180191	missense	probably benign	0.00
R4649:Zfat	UTSW	15	68184476	missense	probably damaging	1.00
R4710:Zfat	UTSW	15	68180282	missense	probably benign
R4712:Zfat	UTSW	15	68110475	critical splice donor site	probably null
R4745:Zfat	UTSW	15	68180374	missense	probably benign	0.09
R4862:Zfat	UTSW	15	68180110	missense	probably benign	0.02
R5015:Zfat	UTSW	15	68178913	missense	probably damaging	1.00
R5075:Zfat	UTSW	15	68180230	missense	probably benign
R5208:Zfat	UTSW	15	68180721	missense	probably damaging	1.00
R5303:Zfat	UTSW	15	68110486	missense	probably damaging	1.00
R5328:Zfat	UTSW	15	68179828	missense	probably damaging	0.99
R5642:Zfat	UTSW	15	68180916	missense	probably damaging	1.00
R5659:Zfat	UTSW	15	68119013	missense	probably damaging	1.00
R5947:Zfat	UTSW	15	68179957	missense	probably benign
R6046:Zfat	UTSW	15	68180777	missense	probably damaging	0.99
R6315:Zfat	UTSW	15	68084462	missense	probably damaging	1.00
R6342:Zfat	UTSW	15	68180982	missense	probably damaging	1.00
R6573:Zfat	UTSW	15	68165854	missense	probably damaging	1.00
R6789:Zfat	UTSW	15	68084386	missense	probably damaging	1.00
R7028:Zfat	UTSW	15	68180452	missense	probably damaging	1.00
R7033:Zfat	UTSW	15	68181015	missense	probably damaging	1.00
R7039:Zfat	UTSW	15	68180362	missense	probably benign
R7065:Zfat	UTSW	15	68181120	missense	probably damaging	1.00
R7144:Zfat	UTSW	15	68178782	missense	probably benign	0.12
R7208:Zfat	UTSW	15	68180007	missense	probably benign	0.39
R7330:Zfat	UTSW	15	68212751	missense	probably benign	0.00
R7345:Zfat	UTSW	15	68105043	missense	probably damaging	1.00
R7378:Zfat	UTSW	15	68181120	missense	probably damaging	1.00
R7405:Zfat	UTSW	15	68184485	missense	probably damaging	1.00
R7481:Zfat	UTSW	15	68178866	nonsense	probably null
R7672:Zfat	UTSW	15	68258686	start codon destroyed	probably null	0.39
R7676:Zfat	UTSW	15	68224844	missense	possibly damaging	0.88
R7701:Zfat	UTSW	15	68180908	nonsense	probably null
R7825:Zfat	UTSW	15	68179920	missense	probably benign	0.01
Z1088:Zfat	UTSW	15	68187101	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TTGGGAACTCACCATCAGACG -3'
(R):5'- TAGAACTGTCCTGAAGCCGAGG -3'

Sequencing Primer
(F):5'- CTCACCATCAGACGTGTGAAGG -3'
(R):5'- CGGTATTTCTGTAAGGCGGAAC -3'

Posted On

2016-07-22