Incidental Mutation 'R0498:Kdr'
ID40597
Institutional Source Beutler Lab
Gene Symbol Kdr
Ensembl Gene ENSMUSG00000062960
Gene Namekinase insert domain protein receptor
SynonymsFlk1, vascular endothelial growth factor receptor- 2, VEGF receptor-2, VEGFR2, VEGFR-2, Flk-1
MMRRC Submission 038694-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0498 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location75932827-75978458 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 75959138 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 654 (V654I)
Ref Sequence ENSEMBL: ENSMUSP00000109144 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113516]
Predicted Effect probably benign
Transcript: ENSMUST00000113516
AA Change: V654I

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000109144
Gene: ENSMUSG00000062960
AA Change: V654I

DomainStartEndE-ValueType
IG 38 121 2.43e-2 SMART
IG_like 137 220 5.91e1 SMART
IG 233 327 2.64e-12 SMART
IG 339 420 1.2e-6 SMART
IG 432 546 2.14e0 SMART
IG 554 657 2.79e-2 SMART
IGc2 677 742 8.42e-20 SMART
TyrKc 832 1158 7.07e-138 SMART
low complexity region 1310 1315 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149573
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202473
Meta Mutation Damage Score 0.0639 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 96.9%
  • 20x: 94.4%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vascular endothelial growth factor (VEGF) is a major growth factor for endothelial cells. This gene encodes one of the two receptors of the VEGF. This receptor, known as kinase insert domain receptor, is a type III receptor tyrosine kinase. It functions as the main mediator of VEGF-induced endothelial proliferation, survival, migration, tubular morphogenesis and sprouting. The signalling and trafficking of this receptor are regulated by multiple factors, including Rab GTPase, P2Y purine nucleotide receptor, integrin alphaVbeta3, T-cell protein tyrosine phosphatase, etc.. Mutations of this gene are implicated in infantile capillary hemangiomas. [provided by RefSeq, May 2009]
PHENOTYPE: Homozygous mice die at early embryonic stages due to failure of blood vessel formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik A T 7: 40,993,294 D220V probably benign Het
4933406M09Rik A G 1: 134,390,872 I461V possibly damaging Het
6720489N17Rik T C 13: 62,607,387 N39S probably damaging Het
Adgrf2 A G 17: 42,714,315 probably benign Het
Aldh18a1 A G 19: 40,574,272 V219A probably benign Het
Anapc10 A G 8: 79,774,981 D126G probably benign Het
Ap1m2 T C 9: 21,295,833 *426W probably null Het
Arhgap21 A G 2: 20,863,117 I865T probably damaging Het
Armc8 A G 9: 99,497,292 V527A probably damaging Het
Asic5 A T 3: 82,006,471 probably benign Het
Baz2b A C 2: 59,901,996 probably benign Het
Bpifa5 T C 2: 154,167,249 V237A probably damaging Het
Brip1 T A 11: 86,197,919 K52I possibly damaging Het
Cacna1g T C 11: 94,459,859 I387V probably damaging Het
Cbr4 A G 8: 61,495,073 I135V probably benign Het
Ccdc66 C T 14: 27,500,240 probably null Het
Cubn G A 2: 13,444,267 T999M probably damaging Het
Dpp8 C T 9: 65,045,795 probably benign Het
Dsg1b T C 18: 20,409,333 S966P possibly damaging Het
Erp27 T C 6: 136,919,864 probably benign Het
Fat4 A T 3: 38,980,637 I2813L probably benign Het
Fhod1 G A 8: 105,329,856 R1101C probably damaging Het
Hoxc9 T C 15: 102,983,927 S191P probably damaging Het
Izumo4 T C 10: 80,704,196 probably null Het
Kalrn C T 16: 34,054,891 D104N possibly damaging Het
Kank4 A T 4: 98,779,636 D191E probably benign Het
Kbtbd11 A G 8: 15,027,605 E68G probably benign Het
Klra1 A T 6: 130,372,819 probably null Het
Kmt2e T A 5: 23,478,972 Y373* probably null Het
Lepr A T 4: 101,745,692 M226L probably benign Het
Lrp1b T A 2: 41,458,405 I800F probably benign Het
Lta4h T C 10: 93,471,971 probably benign Het
Map3k7 T C 4: 31,974,814 probably benign Het
Map4k4 G A 1: 39,990,178 R371Q probably benign Het
Mme A G 3: 63,346,066 I444V probably damaging Het
Mms19 C T 19: 41,949,773 R582Q possibly damaging Het
Mtss1 A G 15: 58,945,437 S502P probably damaging Het
Myo3a G T 2: 22,577,429 A232S possibly damaging Het
Nwd2 G T 5: 63,806,343 W1090L probably damaging Het
Olfr727 A C 14: 50,127,293 T239P probably damaging Het
Olfr874 G A 9: 37,746,254 G40E probably damaging Het
Pcm1 G A 8: 41,293,769 S1335N probably benign Het
Pdzph1 A G 17: 58,973,830 F486L probably benign Het
Piezo2 T C 18: 63,102,174 K552R possibly damaging Het
Plekhs1 T A 19: 56,481,104 probably null Het
Pprc1 C T 19: 46,071,568 Q1514* probably null Het
Ralgapa1 T C 12: 55,689,791 T1831A possibly damaging Het
Rnpep G T 1: 135,265,352 D455E probably damaging Het
Rpgrip1 T A 14: 52,131,314 probably benign Het
Saxo1 A T 4: 86,478,896 M135K possibly damaging Het
Serpina12 T C 12: 104,035,789 T223A probably damaging Het
Serpinb3a A G 1: 107,047,150 F218L probably damaging Het
Serpinb9f T G 13: 33,326,007 probably benign Het
Spata33 A G 8: 123,221,923 D98G probably benign Het
Stard13 T A 5: 151,052,477 Y742F probably damaging Het
Tcrg-C3 T A 13: 19,261,092 M70K probably damaging Het
Tecta A G 9: 42,377,614 Y552H probably damaging Het
Tie1 A T 4: 118,479,161 probably benign Het
Tmem161a A G 8: 70,180,973 T254A probably benign Het
Tmem30a G T 9: 79,774,094 Y264* probably null Het
Tmem87a A T 2: 120,394,465 I105K probably benign Het
Tnrc6b A T 15: 80,858,719 D51V probably damaging Het
Trpc4 T C 3: 54,291,211 F519L probably damaging Het
Ttn T C 2: 76,709,581 T26027A probably damaging Het
Vmn1r198 A C 13: 22,354,974 H121P probably damaging Het
Vps33a A G 5: 123,570,961 F64L probably benign Het
Wdr63 G T 3: 146,081,364 D305E possibly damaging Het
Zfp994 A T 17: 22,200,901 C356S probably damaging Het
Other mutations in Kdr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Kdr APN 5 75968750 missense probably damaging 1.00
IGL01094:Kdr APN 5 75961760 missense probably benign 0.00
IGL01310:Kdr APN 5 75949601 missense probably damaging 1.00
IGL01689:Kdr APN 5 75936840 missense probably benign 0.01
IGL01986:Kdr APN 5 75952859 missense probably benign 0.18
IGL02065:Kdr APN 5 75961853 splice site probably benign
IGL02200:Kdr APN 5 75950102 splice site probably benign
IGL02272:Kdr APN 5 75961840 missense probably benign
IGL02426:Kdr APN 5 75974466 missense probably benign 0.00
IGL02483:Kdr APN 5 75936294 critical splice donor site probably null
IGL02543:Kdr APN 5 75964947 splice site probably benign
IGL02590:Kdr APN 5 75936323 missense probably benign 0.00
IGL03204:Kdr APN 5 75972382 missense possibly damaging 0.96
IGL03228:Kdr APN 5 75957048 missense probably damaging 0.97
IGL03265:Kdr APN 5 75960773 missense probably damaging 1.00
engelein UTSW 5 75952889 missense probably damaging 1.00
PIT4131001:Kdr UTSW 5 75941971 splice site probably benign
PIT4519001:Kdr UTSW 5 75936896 missense possibly damaging 0.86
R0133:Kdr UTSW 5 75951838 missense probably damaging 1.00
R0197:Kdr UTSW 5 75968422 missense possibly damaging 0.82
R0282:Kdr UTSW 5 75950100 splice site probably benign
R0309:Kdr UTSW 5 75946927 splice site probably benign
R0371:Kdr UTSW 5 75941834 missense probably benign 0.22
R0396:Kdr UTSW 5 75960728 missense possibly damaging 0.65
R0932:Kdr UTSW 5 75968805 missense probably benign 0.02
R1077:Kdr UTSW 5 75956231 missense probably damaging 1.00
R1183:Kdr UTSW 5 75946851 missense probably damaging 1.00
R1713:Kdr UTSW 5 75968467 missense probably benign 0.03
R1853:Kdr UTSW 5 75952905 missense possibly damaging 0.67
R1854:Kdr UTSW 5 75952905 missense possibly damaging 0.67
R2142:Kdr UTSW 5 75968423 missense possibly damaging 0.56
R2238:Kdr UTSW 5 75949519 missense possibly damaging 0.78
R2891:Kdr UTSW 5 75946836 missense probably damaging 1.00
R2893:Kdr UTSW 5 75946836 missense probably damaging 1.00
R2894:Kdr UTSW 5 75946836 missense probably damaging 1.00
R2903:Kdr UTSW 5 75966409 missense probably damaging 1.00
R2904:Kdr UTSW 5 75966409 missense probably damaging 1.00
R3155:Kdr UTSW 5 75968405 missense probably benign 0.02
R3939:Kdr UTSW 5 75972429 nonsense probably null
R4051:Kdr UTSW 5 75968408 missense probably benign
R4151:Kdr UTSW 5 75957101 missense possibly damaging 0.94
R4433:Kdr UTSW 5 75943925 missense possibly damaging 0.61
R4687:Kdr UTSW 5 75968792 missense possibly damaging 0.81
R4691:Kdr UTSW 5 75944599 missense possibly damaging 0.79
R5185:Kdr UTSW 5 75952417 splice site probably null
R5544:Kdr UTSW 5 75960743 nonsense probably null
R6083:Kdr UTSW 5 75944366 missense probably damaging 1.00
R6477:Kdr UTSW 5 75968841 missense probably benign 0.02
R6568:Kdr UTSW 5 75961774 missense probably benign 0.01
R6647:Kdr UTSW 5 75952889 missense probably damaging 1.00
R6827:Kdr UTSW 5 75944545 missense probably damaging 1.00
R6887:Kdr UTSW 5 75968451 missense probably benign 0.00
R6929:Kdr UTSW 5 75978104 missense probably benign 0.16
R6993:Kdr UTSW 5 75972411 missense probably benign
R7022:Kdr UTSW 5 75972260 nonsense probably null
R7050:Kdr UTSW 5 75950120 missense probably damaging 1.00
R7099:Kdr UTSW 5 75944333 missense probably damaging 0.98
R7274:Kdr UTSW 5 75964700 missense probably benign 0.00
R7310:Kdr UTSW 5 75944325 missense probably damaging 0.99
R7565:Kdr UTSW 5 75948843 missense probably damaging 0.97
X0024:Kdr UTSW 5 75974406 missense probably damaging 1.00
Z1177:Kdr UTSW 5 75968475 missense not run
Predicted Primers PCR Primer
(F):5'- TTGGAGACACCACAATGGCACGAC -3'
(R):5'- AGCTTGGCTCACAGGCAACATC -3'

Sequencing Primer
(F):5'- ATCATCTGAATGTCCAGGGATGC -3'
(R):5'- GTCCACATGGGCGAATCAC -3'
Posted On2013-05-23