Mutagenetix > Incidental Mutations

Incidental Mutation 'R5354:Cpox'

424005

Institutional Source

Beutler Lab

Gene Symbol

Cpox

Ensembl Gene

ENSMUSG00000022742

Gene Name

coproporphyrinogen oxidase

Synonyms

nct, Cpo, cac, clone 560

MMRRC Submission

042933-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.909) question?

Stock #

R5354 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

58670292-58717636 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 58670842 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 139 (T139A)

Ref Sequence

ENSEMBL: ENSMUSP00000055455 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060077]

Predicted Effect

probably damaging
Transcript: ENSMUST00000060077
AA Change: T139A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000055455
Gene: ENSMUSG00000022742
AA Change: T139A

Domain	Start	End	E-Value	Type
low complexity region	57	81	N/A	INTRINSIC
low complexity region	94	105	N/A	INTRINSIC
Pfam:Coprogen_oxidas	140	442	7.6e-142	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000231276

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000232176

Meta Mutation Damage Score

0.1269

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

100% (80/80)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is the sixth enzyme of the heme biosynthetic pathway. The encoded enzyme is soluble and found in the intermembrane space of mitochondria. This enzyme catalyzes the stepwise oxidative decarboxylation of coproporphyrinogen III to protoporphyrinogen IX, a precursor of heme. Defects in this gene are a cause of hereditary coproporphyria (HCP).[provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a spontaneous allele develop cataracts. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A630010A05Rik	A	G	16: 14,618,671	K196R	probably benign	Het
Ablim1	T	C	19: 57,130,923	E243G	probably benign	Het
Acat1	T	A	9: 53,589,183	E271V	possibly damaging	Het
Aco1	T	C	4: 40,180,290		probably null	Het
Adam22	C	A	5: 8,090,182	G202W	probably damaging	Het
Agbl3	T	A	6: 34,814,752	H596Q	probably benign	Het
Anxa7	A	G	14: 20,464,909	L177P	possibly damaging	Het
Atp11a	A	T	8: 12,806,753	N48I	probably damaging	Het
Bcas1	T	A	2: 170,349,396	N492I	possibly damaging	Het
Bclaf1	A	G	10: 20,333,532	Y498C	probably damaging	Het
Bod1l	A	C	5: 41,831,537	V409G	probably damaging	Het
Ccdc170	G	A	10: 4,534,188	C338Y	probably benign	Het
Cdc45	C	T	16: 18,795,897	R205H	probably damaging	Het
Ckap2	A	C	8: 22,177,565	N93K	probably damaging	Het
Clca3a1	A	T	3: 144,737,005	S759R	possibly damaging	Het
Coro1c	A	T	5: 113,846,165	I347N	possibly damaging	Het
Cyp4a12b	C	A	4: 115,433,464		probably null	Het
Dctn1	T	G	6: 83,183,126	V116G	possibly damaging	Het
Dhx38	A	G	8: 109,555,746	V683A	probably damaging	Het
Dnah12	G	A	14: 26,774,342		probably null	Het
Dnajb7	T	C	15: 81,408,007	E43G	probably damaging	Het
Dsc1	A	T	18: 20,087,575	V714E	probably damaging	Het
Dupd1	G	A	14: 21,677,023	R186W	probably benign	Het
Egfem1	T	C	3: 29,082,212		probably null	Het
Fchsd1	C	T	18: 37,959,873		probably benign	Het
Fmo1	T	C	1: 162,830,145	T476A	probably benign	Het
Gm10237	T	C	16: 35,920,729		noncoding transcript	Het
Gm14496	A	G	2: 182,000,809	S758G	probably damaging	Het
Gpat2	T	A	2: 127,428,723	L97Q	probably damaging	Het
Gpr162	T	C	6: 124,859,637	D357G	probably benign	Het
Hax1	A	T	3: 89,997,955	D34E	probably damaging	Het
Hmgcr	C	T	13: 96,654,896	V97M	probably benign	Het
Hsd3b2	T	C	3: 98,712,315	T105A	probably benign	Het
Ints1	A	G	5: 139,766,428		probably null	Het
Islr	T	C	9: 58,157,612	E204G	probably damaging	Het
Lrrc36	A	G	8: 105,425,364	N60D	probably damaging	Het
Maf1	T	C	15: 76,353,130		probably benign	Het
Mrgprb4	T	A	7: 48,198,329	R284W	probably benign	Het
Myh4	A	T	11: 67,255,725	N1508I	possibly damaging	Het
Nufip2	A	G	11: 77,686,277	H17R	unknown	Het
Oasl1	A	T	5: 114,936,996	I372L	probably damaging	Het
Olfr290	T	A	7: 84,916,149	Y123*	probably null	Het
Olfr414	T	C	1: 174,430,686	L86P	probably damaging	Het
Pald1	A	T	10: 61,348,661	Y226N	probably damaging	Het
Pcdhb13	G	T	18: 37,444,791	G741C	probably damaging	Het
Pcdhga10	A	G	18: 37,748,206	D340G	probably damaging	Het
Pclo	C	A	5: 14,678,808		probably benign	Het
Pcsk4	G	T	10: 80,323,689	N416K	probably damaging	Het
Pde10a	C	A	17: 8,961,980	R398S	probably damaging	Het
Plin1	T	A	7: 79,725,721	T227S	possibly damaging	Het
Pnpt1	A	G	11: 29,154,166	D542G	probably damaging	Het
Ppp4r3b	T	A	11: 29,211,646	D673E	probably benign	Het
Prr18	C	A	17: 8,341,060	P16Q	probably damaging	Het
Psmc3	T	A	2: 91,059,353	Y440N	probably damaging	Het
Rassf5	T	C	1: 131,180,648	I232V	probably benign	Het
Rims1	T	A	1: 22,538,511	D218V	probably damaging	Het
Skint10	T	C	4: 112,711,593	N309S	possibly damaging	Het
Slc6a1	T	C	6: 114,302,623	M121T	possibly damaging	Het
Slit3	A	G	11: 35,675,913	D1004G	probably damaging	Het
Snap91	C	T	9: 86,835,124	V215I	possibly damaging	Het
Son	T	C	16: 91,655,739	L458S	probably damaging	Het
St18	C	T	1: 6,844,171	A782V	probably damaging	Het
Synpo	A	G	18: 60,602,231		probably null	Het
Thbs3	A	G	3: 89,221,377	D458G	probably damaging	Het
Tpr	C	T	1: 150,445,924	R3C	probably damaging	Het
Trp63	A	G	16: 25,684,355		probably null	Het
Uhrf1bp1	G	A	17: 27,887,515	S1005N	probably benign	Het
Vmn1r27	C	A	6: 58,215,596	R141L	probably benign	Het
Wnk1	T	C	6: 119,968,523	I699V	probably benign	Het
Xkr6	A	G	14: 63,818,904	D88G	possibly damaging	Het
Zan	A	G	5: 137,380,788		probably benign	Het
Zbtb7b	T	C	3: 89,379,606		probably benign	Het
Zfp618	A	T	4: 63,080,028	D33V	probably damaging	Het

Other mutations in Cpox

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02152:Cpox	APN	16	58674424	missense	possibly damaging	0.87
IGL03031:Cpox	APN	16	58672560	missense	probably damaging	1.00
IGL03034:Cpox	APN	16	58675355	missense	probably damaging	0.98
scraggy	UTSW	16	58670935	missense	probably damaging	1.00
R0413:Cpox	UTSW	16	58670869	missense	possibly damaging	0.52
R0523:Cpox	UTSW	16	58675245	nonsense	probably null
R0551:Cpox	UTSW	16	58675390	missense	probably benign	0.11
R2064:Cpox	UTSW	16	58674409	missense	probably benign	0.36
R4651:Cpox	UTSW	16	58670687	missense	possibly damaging	0.92
R4701:Cpox	UTSW	16	58677969	nonsense	probably null
R4782:Cpox	UTSW	16	58672623	missense	probably damaging	1.00
R5285:Cpox	UTSW	16	58675286	missense	probably damaging	1.00
R5287:Cpox	UTSW	16	58675286	missense	probably damaging	1.00
R5313:Cpox	UTSW	16	58677948	nonsense	probably null
R5346:Cpox	UTSW	16	58675286	missense	probably damaging	1.00
R5404:Cpox	UTSW	16	58675286	missense	probably damaging	1.00
R5476:Cpox	UTSW	16	58678725	missense	probably damaging	0.99
R5853:Cpox	UTSW	16	58675417	missense	probably damaging	0.99
R6026:Cpox	UTSW	16	58670935	missense	probably damaging	1.00
R7059:Cpox	UTSW	16	58670927	missense	probably damaging	1.00
R7061:Cpox	UTSW	16	58670860	missense	possibly damaging	0.76
R7606:Cpox	UTSW	16	58674449	missense	probably benign	0.16
RF059:Cpox	UTSW	16	58670767	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCTGCAGGATCGGATTTGCC -3'
(R):5'- GTCCCTTCTGACAGATCACC -3'

Sequencing Primer
(F):5'- AGGATCGGATTTGCCCAGTC -3'
(R):5'- AACTGTTCTACTTTAAATCCCCAATC -3'

Posted On

2016-08-04