Incidental Mutation 'R5517:Gdpd1'
ID431364
Institutional Source Beutler Lab
Gene Symbol Gdpd1
Ensembl Gene ENSMUSG00000061666
Gene Nameglycerophosphodiester phosphodiesterase domain containing 1
Synonyms
MMRRC Submission 043076-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R5517 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location87033867-87074062 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 87059506 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 80 (D80E)
Ref Sequence ENSEMBL: ENSMUSP00000020804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020804]
Predicted Effect probably damaging
Transcript: ENSMUST00000020804
AA Change: D80E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020804
Gene: ENSMUSG00000061666
AA Change: D80E

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:GDPD 45 204 1.2e-26 PFAM
low complexity region 206 217 N/A INTRINSIC
Meta Mutation Damage Score 0.6334 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.2%
  • 20x: 90.5%
Validation Efficiency 99% (67/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycerophosphodiester phosphodiesterase family of enzymes that catalyze the hydrolysis of deacylated glycerophospholipids to glycerol phosphate and alcohol. The encoded protein is localized to the cytoplasm and concentrates near the perinuclear region. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcf1 C T 17: 35,958,341 R675K possibly damaging Het
Aire A T 10: 78,039,691 S282T probably benign Het
Ak9 A G 10: 41,340,891 E283G probably benign Het
Akap2 T C 4: 57,855,987 Y439H probably damaging Het
Akap9 T A 5: 4,001,665 D1477E possibly damaging Het
Ap2a1 T C 7: 44,906,981 D273G possibly damaging Het
Apob T C 12: 7,990,906 L664P probably damaging Het
Arhgap35 A T 7: 16,563,489 F550L probably damaging Het
Armc2 T C 10: 41,963,850 E373G probably benign Het
Atp8b2 C A 3: 89,946,031 A726S probably benign Het
C030048H21Rik T A 2: 26,255,887 Q87L probably damaging Het
Cd244 T A 1: 171,577,974 probably benign Het
Cdk10 T A 8: 123,230,587 probably null Het
Cenpe C A 3: 135,223,265 P310Q probably damaging Het
Chuk T A 19: 44,097,533 probably null Het
Crebl2 T C 6: 134,851,176 S104P probably benign Het
Ddo A G 10: 40,647,730 K239E probably benign Het
Defb5 A G 8: 19,250,852 probably null Het
Dhx35 T A 2: 158,834,912 M422K probably damaging Het
Fchsd1 C T 18: 37,959,873 probably benign Het
Gatm G A 2: 122,595,543 T409I probably damaging Het
Gspt1 C A 16: 11,253,979 G7C unknown Het
Hells G A 19: 38,954,800 S516N probably benign Het
Ints1 A G 5: 139,752,787 S2069P possibly damaging Het
Kank4 G A 4: 98,774,881 T690M probably damaging Het
Kcnq4 T C 4: 120,715,809 N265S possibly damaging Het
Kif5b C A 18: 6,220,954 A385S probably benign Het
Map2 T C 1: 66,415,256 S1102P probably benign Het
Mcm7 A G 5: 138,164,871 S340P possibly damaging Het
Mcrs1 C T 15: 99,246,995 R246H possibly damaging Het
Myo16 T A 8: 10,560,226 M1189K probably benign Het
Olfr1302 G T 2: 111,780,459 M46I probably benign Het
Olfr463 A T 11: 87,893,066 I286N probably damaging Het
Olfr847 G A 9: 19,375,767 T38I probably damaging Het
Otog A G 7: 46,274,571 N1118S probably damaging Het
Pcdhb7 G T 18: 37,341,793 probably benign Het
Picalm C T 7: 90,170,598 T189I possibly damaging Het
Ptx4 T A 17: 25,124,786 S337T possibly damaging Het
Rad51ap2 C T 12: 11,458,312 S745L probably benign Het
Rspry1 G A 8: 94,636,760 probably null Het
Scn5a T G 9: 119,495,713 I1350L probably damaging Het
Sgk2 T C 2: 162,997,835 L121P probably damaging Het
Slc17a1 A T 13: 23,872,592 probably benign Het
Slc6a12 A G 6: 121,354,339 N183S probably benign Het
Smg9 C A 7: 24,414,913 probably benign Het
Spred1 G A 2: 117,177,714 S367N probably damaging Het
Srpr T C 9: 35,211,350 V21A probably benign Het
Taar2 A T 10: 23,940,729 I56F possibly damaging Het
Taf1a T G 1: 183,395,985 L67R probably damaging Het
Tbc1d10b C A 7: 127,198,607 R787S possibly damaging Het
Topbp1 T A 9: 103,336,114 N1044K probably benign Het
Usp24 A G 4: 106,375,674 T886A probably benign Het
Vmn2r26 A G 6: 124,050,717 D472G probably damaging Het
Zyg11a T C 4: 108,204,746 N286S possibly damaging Het
Other mutations in Gdpd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02279:Gdpd1 APN 11 87073901 missense probably benign 0.00
IGL02585:Gdpd1 APN 11 87073976 start codon destroyed probably null 0.98
PIT4687001:Gdpd1 UTSW 11 87059540 missense probably damaging 1.00
R0947:Gdpd1 UTSW 11 87037881 missense probably benign
R1454:Gdpd1 UTSW 11 87059509 missense possibly damaging 0.95
R2086:Gdpd1 UTSW 11 87035268 missense probably benign
R2183:Gdpd1 UTSW 11 87035276 missense probably damaging 1.00
R4416:Gdpd1 UTSW 11 87035288 missense probably benign 0.44
R7038:Gdpd1 UTSW 11 87035292 missense probably damaging 1.00
R7898:Gdpd1 UTSW 11 87041813 missense probably damaging 0.98
R7981:Gdpd1 UTSW 11 87041813 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGCTTCAAGGCTTTGACATGC -3'
(R):5'- ACGATAAATGTGGTTGGGCTATTTC -3'

Sequencing Primer
(F):5'- GTGAGCCATCATCAGCTTAATC -3'
(R):5'- CAGTGTCATGGGATACTTTGGAC -3'
Posted On2016-10-05