Incidental Mutation 'PIT4687001:Gdpd1'
ID556198
Institutional Source Beutler Lab
Gene Symbol Gdpd1
Ensembl Gene ENSMUSG00000061666
Gene Nameglycerophosphodiester phosphodiesterase domain containing 1
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #PIT4687001 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location87033867-87074062 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87059540 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 69 (D69G)
Ref Sequence ENSEMBL: ENSMUSP00000020804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020804]
Predicted Effect probably damaging
Transcript: ENSMUST00000020804
AA Change: D69G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020804
Gene: ENSMUSG00000061666
AA Change: D69G

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:GDPD 45 204 1.2e-26 PFAM
low complexity region 206 217 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.4%
  • 3x: 90.8%
  • 10x: 84.7%
  • 20x: 71.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the glycerophosphodiester phosphodiesterase family of enzymes that catalyze the hydrolysis of deacylated glycerophospholipids to glycerol phosphate and alcohol. The encoded protein is localized to the cytoplasm and concentrates near the perinuclear region. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adh1 T G 3: 138,289,835 V333G probably damaging Het
Aggf1 A G 13: 95,364,875 L333P probably damaging Het
Ankmy1 A G 1: 92,885,081 V502A probably benign Het
Atm A G 9: 53,486,812 probably null Het
Ccdc180 A G 4: 45,949,526 T1594A probably damaging Het
Cep290 T A 10: 100,537,591 D1244E probably benign Het
Ctnna3 A G 10: 64,834,606 D638G probably damaging Het
Ctsr T C 13: 61,160,532 H266R possibly damaging Het
D630045J12Rik C T 6: 38,195,101 E711K probably benign Het
Dnah5 T C 15: 28,383,577 S2982P probably damaging Het
Dsg1a G T 18: 20,331,698 A417S probably benign Het
Gm13103 C T 4: 143,846,533 probably benign Het
Gp2 C T 7: 119,451,578 R310H possibly damaging Het
Ifna2 G A 4: 88,683,305 H159Y possibly damaging Het
Kptn T C 7: 16,125,826 V325A probably damaging Het
March7 A G 2: 60,232,278 E143G probably damaging Het
Mcm4 A G 16: 15,636,713 L47P probably benign Het
Mcm8 T C 2: 132,817,177 F27S possibly damaging Het
Nod2 T A 8: 88,681,646 V967E probably damaging Het
Nrxn2 G A 19: 6,481,308 R659Q probably benign Het
Olfr120 T G 17: 37,726,191 C56G probably benign Het
Olfr1267-ps1 A G 2: 90,086,389 V24A probably benign Het
Parp10 C T 15: 76,240,922 R545Q probably benign Het
Ppp2r3a T C 9: 101,144,380 E332G probably benign Het
Ptpdc1 A G 13: 48,586,290 V555A probably benign Het
Qsox2 G A 2: 26,222,288 L81F possibly damaging Het
Sbsn GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA GAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCATGGGGTACAGAATGGAGTCAACCAGGCTCAAAAGGAAGCAGAAAAAGTGGCCCA 7: 30,752,966 probably benign Het
Spata31 A G 13: 64,921,337 D433G probably benign Het
Stpg2 T C 3: 139,215,265 I77T possibly damaging Het
Sugp2 T C 8: 70,257,512 S928P probably damaging Het
Syne1 A G 10: 5,358,390 S722P possibly damaging Het
Szt2 A T 4: 118,398,201 S229T possibly damaging Het
Tm9sf3 A G 19: 41,218,191 L505P probably damaging Het
Ttc39d G A 17: 80,216,925 A338T probably damaging Het
Ubash3b A G 9: 41,023,518 F489L probably damaging Het
Xpo7 A T 14: 70,667,149 Y1015N probably benign Het
Zbtb14 C A 17: 69,388,307 Y333* probably null Het
Zp2 T C 7: 120,141,879 T141A probably benign Het
Other mutations in Gdpd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02279:Gdpd1 APN 11 87073901 missense probably benign 0.00
IGL02585:Gdpd1 APN 11 87073976 start codon destroyed probably null 0.98
R0947:Gdpd1 UTSW 11 87037881 missense probably benign
R1454:Gdpd1 UTSW 11 87059509 missense possibly damaging 0.95
R2086:Gdpd1 UTSW 11 87035268 missense probably benign
R2183:Gdpd1 UTSW 11 87035276 missense probably damaging 1.00
R4416:Gdpd1 UTSW 11 87035288 missense probably benign 0.44
R5517:Gdpd1 UTSW 11 87059506 missense probably damaging 1.00
R7038:Gdpd1 UTSW 11 87035292 missense probably damaging 1.00
R7898:Gdpd1 UTSW 11 87041813 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGCTCTCTTCTGCCTTAAAAGC -3'
(R):5'- CTATGGAAGAGGCAACATGATTCAC -3'

Sequencing Primer
(F):5'- CTGCCTTAAAAGCATTTCCTTTAAG -3'
(R):5'- GGCAACATGATTCACCAATTATAAG -3'
Posted On2019-06-07