Mutagenetix > Incidental Mutation

Incidental Mutation 'R5454:Umodl1'

432695

Institutional Source

Beutler Lab

Gene Symbol

Umodl1

Ensembl Gene

ENSMUSG00000054134

Gene Name

uromodulin-like 1

Synonyms

D17Ertd488e

MMRRC Submission

043018-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5454 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

31173614-31229684 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 31205439 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 649 (D649V)

Ref Sequence

ENSEMBL: ENSMUSP00000065470 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066554] [ENSMUST00000066981] [ENSMUST00000114555]

AlphaFold

Q5DID3

Predicted Effect

probably benign
Transcript: ENSMUST00000066554
AA Change: D678V

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000067443
Gene: ENSMUSG00000054134
AA Change: D678V

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
EGF	503	545	4.63e-1	SMART
low complexity region	651	661	N/A	INTRINSIC
FN3	736	811	6.01e-5	SMART
SEA	821	936	8.88e-2	SMART
EGF	933	974	4.26e0	SMART
ZP	1024	1267	5.44e-25	SMART
transmembrane domain	1301	1323	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000066981
AA Change: D649V

PolyPhen 2 Score 0.775 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000065470
Gene: ENSMUSG00000054134
AA Change: D649V

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:EMI	34	102	8.7e-13	PFAM
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
Pfam:SEA	388	492	8.9e-15	PFAM
EGF	503	545	4.63e-1	SMART
low complexity region	619	632	N/A	INTRINSIC
SEA	706	821	8.88e-2	SMART
EGF	818	859	4.26e0	SMART
ZP	909	1152	5.44e-25	SMART
transmembrane domain	1186	1208	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000114555
AA Change: D678V

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000110202
Gene: ENSMUSG00000054134
AA Change: D678V

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Pfam:EMI	34	102	9.7e-13	PFAM
WAP	118	159	3.15e-4	SMART
EGF_like	265	306	3.72e-2	SMART
FN3	305	381	2.61e0	SMART
Pfam:SEA	388	492	9.9e-15	PFAM
EGF	503	545	4.63e-1	SMART
low complexity region	651	661	N/A	INTRINSIC
FN3	736	811	6.01e-5	SMART
SEA	821	936	8.88e-2	SMART
EGF	933	974	4.26e0	SMART
ZP	1024	1267	5.44e-25	SMART
transmembrane domain	1301	1323	N/A	INTRINSIC

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.2%
20x: 95.1%

Validation Efficiency

100% (60/60)

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930579C12Rik	T	C	9: 89,051,041 (GRCm39)		noncoding transcript	Het
Ankfy1	A	T	11: 72,637,757 (GRCm39)	H483L	probably benign	Het
Ankrd46	C	T	15: 36,479,447 (GRCm39)	G215R	probably damaging	Het
Apobec1	T	C	6: 122,558,327 (GRCm39)	I143V	probably benign	Het
Atp2b4	C	A	1: 133,657,610 (GRCm39)	V627F	probably damaging	Het
Ccdc80	T	A	16: 44,947,588 (GRCm39)	Y855*	probably null	Het
Cd209b	T	C	8: 3,975,396 (GRCm39)	E88G	probably damaging	Het
Ceacam14	T	G	7: 17,548,110 (GRCm39)	W67G	probably damaging	Het
Cope	T	C	8: 70,757,306 (GRCm39)	V50A	probably benign	Het
Dcaf13	C	A	15: 38,987,759 (GRCm39)	D168E	probably benign	Het
Dhcr7	T	G	7: 143,391,576 (GRCm39)	M55R	probably damaging	Het
Enpp7	A	T	11: 118,879,634 (GRCm39)	Y96F	probably benign	Het
Esco1	T	C	18: 10,584,327 (GRCm39)	D60G	probably benign	Het
Fgfr3	G	A	5: 33,880,642 (GRCm39)		probably benign	Het
Frzb	T	C	2: 80,248,259 (GRCm39)	D280G	probably damaging	Het
Gcat	A	G	15: 78,920,610 (GRCm39)	I317V	probably benign	Het
Gm13030	A	T	4: 138,600,820 (GRCm39)		probably benign	Het
Gmds	A	G	13: 32,312,024 (GRCm39)	L135P	probably damaging	Het
Htra2	G	A	6: 83,030,995 (GRCm39)	P138L	probably damaging	Het
Il5	A	G	11: 53,614,626 (GRCm39)	N89S	probably damaging	Het
Ints3	G	A	3: 90,315,834 (GRCm39)	T310M	possibly damaging	Het
Itih2	T	C	2: 10,102,804 (GRCm39)	I777V	probably null	Het
Kctd9	T	C	14: 67,977,836 (GRCm39)	L382S	probably damaging	Het
Loricrin	A	G	3: 91,988,789 (GRCm39)	S166P	unknown	Het
Mga	T	A	2: 119,733,810 (GRCm39)	N219K	probably damaging	Het
Mtmr4	A	T	11: 87,501,868 (GRCm39)	R641*	probably null	Het
Muc6	C	T	7: 141,235,078 (GRCm39)	A611T	possibly damaging	Het
Obox3-ps8	A	T	17: 36,763,903 (GRCm39)		noncoding transcript	Het
Or5p54	A	T	7: 107,554,096 (GRCm39)	M83L	probably benign	Het
Otud4	C	T	8: 80,377,671 (GRCm39)	L111F	possibly damaging	Het
Pcdhga12	T	A	18: 37,899,314 (GRCm39)	S49T	possibly damaging	Het
Pcdhgc3	A	G	18: 37,941,549 (GRCm39)	D650G	probably damaging	Het
Pcmt1	A	G	10: 7,516,509 (GRCm39)	V167A	probably damaging	Het
Pcnt	A	T	10: 76,225,381 (GRCm39)		probably null	Het
Pcx	G	T	19: 4,652,504 (GRCm39)	V164F	probably damaging	Het
Plekhg4	T	C	8: 106,102,745 (GRCm39)		probably null	Het
Pmch	A	G	10: 87,927,707 (GRCm39)	E136G	probably damaging	Het
Prkar1a	A	G	11: 109,550,886 (GRCm39)	D80G	probably benign	Het
Ryr3	T	C	2: 112,560,647 (GRCm39)		probably null	Het
Slc10a7	T	C	8: 79,413,253 (GRCm39)	S171P	possibly damaging	Het
Sox6	A	T	7: 115,301,008 (GRCm39)	M153K	possibly damaging	Het
Srgap2	T	C	1: 131,217,475 (GRCm39)	I946V	probably benign	Het
Strbp	T	C	2: 37,535,495 (GRCm39)	E71G	probably benign	Het
Synpo2l	C	A	14: 20,712,360 (GRCm39)	A87S	probably damaging	Het
Tnrc18	T	C	5: 142,757,446 (GRCm39)	D1025G	unknown	Het
Tnxb	A	G	17: 34,928,599 (GRCm39)	H2671R	possibly damaging	Het
Tor1b	GGACG	GG	2: 30,846,957 (GRCm39)		probably benign	Het
Usp13	G	T	3: 32,959,585 (GRCm39)	A559S	probably damaging	Het
Vps45	G	A	3: 95,926,969 (GRCm39)	P526L	probably benign	Het
Zfp687	A	G	3: 94,916,457 (GRCm39)	V855A	probably damaging	Het
Zfp771	T	A	7: 126,853,448 (GRCm39)	C205S	probably damaging	Het

Other mutations in Umodl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00915:Umodl1	APN	17	31,227,724 (GRCm39)	utr 3 prime	probably benign
IGL01344:Umodl1	APN	17	31,215,238 (GRCm39)	missense	probably damaging	0.99
IGL01529:Umodl1	APN	17	31,215,233 (GRCm39)	missense	possibly damaging	0.94
IGL01609:Umodl1	APN	17	31,217,800 (GRCm39)	missense	possibly damaging	0.90
IGL01625:Umodl1	APN	17	31,215,229 (GRCm39)	missense	probably benign	0.00
IGL01877:Umodl1	APN	17	31,201,294 (GRCm39)	missense	probably benign	0.00
IGL01977:Umodl1	APN	17	31,192,742 (GRCm39)	missense	probably damaging	0.99
IGL02063:Umodl1	APN	17	31,206,888 (GRCm39)	missense	probably benign	0.07
IGL02160:Umodl1	APN	17	31,205,091 (GRCm39)	missense	probably damaging	0.97
IGL02252:Umodl1	APN	17	31,213,789 (GRCm39)	critical splice donor site	probably null
IGL02427:Umodl1	APN	17	31,187,415 (GRCm39)	splice site	probably benign
IGL02496:Umodl1	APN	17	31,217,628 (GRCm39)	missense	probably damaging	0.99
IGL02633:Umodl1	APN	17	31,208,462 (GRCm39)	missense	probably damaging	1.00
IGL03271:Umodl1	APN	17	31,205,473 (GRCm39)	nonsense	probably null
IGL03392:Umodl1	APN	17	31,215,329 (GRCm39)	missense	probably damaging	0.98
Disquieting	UTSW	17	31,178,129 (GRCm39)	missense	probably damaging	1.00
floored	UTSW	17	31,207,031 (GRCm39)	nonsense	probably null
R7231_umodl1_507	UTSW	17	31,205,090 (GRCm39)	missense	probably damaging	1.00
surprising	UTSW	17	31,205,439 (GRCm39)	missense	possibly damaging	0.77
unsettling	UTSW	17	31,205,528 (GRCm39)	nonsense	probably null
G1citation:Umodl1	UTSW	17	31,205,528 (GRCm39)	nonsense	probably null
PIT4468001:Umodl1	UTSW	17	31,178,252 (GRCm39)	missense	probably damaging	1.00
R0048:Umodl1	UTSW	17	31,187,451 (GRCm39)	missense	probably damaging	1.00
R0048:Umodl1	UTSW	17	31,187,451 (GRCm39)	missense	probably damaging	1.00
R0653:Umodl1	UTSW	17	31,203,002 (GRCm39)	missense	probably benign	0.00
R0831:Umodl1	UTSW	17	31,215,325 (GRCm39)	missense	probably damaging	1.00
R1078:Umodl1	UTSW	17	31,178,347 (GRCm39)	missense	probably benign	0.00
R1166:Umodl1	UTSW	17	31,221,772 (GRCm39)	splice site	probably benign
R1231:Umodl1	UTSW	17	31,178,252 (GRCm39)	missense	probably damaging	1.00
R1459:Umodl1	UTSW	17	31,205,478 (GRCm39)	missense	probably benign	0.05
R1459:Umodl1	UTSW	17	31,201,232 (GRCm39)	splice site	probably benign
R1510:Umodl1	UTSW	17	31,178,203 (GRCm39)	missense	probably damaging	1.00
R1654:Umodl1	UTSW	17	31,206,942 (GRCm39)	missense	probably benign
R1757:Umodl1	UTSW	17	31,227,674 (GRCm39)	missense	probably damaging	0.99
R1781:Umodl1	UTSW	17	31,187,524 (GRCm39)	missense	probably damaging	1.00
R1873:Umodl1	UTSW	17	31,201,238 (GRCm39)	missense	probably damaging	0.99
R1911:Umodl1	UTSW	17	31,211,128 (GRCm39)	missense	possibly damaging	0.74
R1917:Umodl1	UTSW	17	31,203,017 (GRCm39)	missense	probably damaging	1.00
R1918:Umodl1	UTSW	17	31,203,017 (GRCm39)	missense	probably damaging	1.00
R2057:Umodl1	UTSW	17	31,227,740 (GRCm39)	critical splice donor site	probably null
R2058:Umodl1	UTSW	17	31,227,740 (GRCm39)	critical splice donor site	probably null
R2089:Umodl1	UTSW	17	31,190,893 (GRCm39)	missense	probably benign	0.00
R2091:Umodl1	UTSW	17	31,190,893 (GRCm39)	missense	probably benign	0.00
R2091:Umodl1	UTSW	17	31,190,893 (GRCm39)	missense	probably benign	0.00
R2431:Umodl1	UTSW	17	31,211,062 (GRCm39)	missense	possibly damaging	0.79
R2903:Umodl1	UTSW	17	31,211,147 (GRCm39)	missense	probably damaging	1.00
R3032:Umodl1	UTSW	17	31,208,502 (GRCm39)	missense	probably benign	0.01
R3956:Umodl1	UTSW	17	31,221,837 (GRCm39)	missense	probably benign	0.10
R3975:Umodl1	UTSW	17	31,203,763 (GRCm39)	nonsense	probably null
R4207:Umodl1	UTSW	17	31,178,341 (GRCm39)	missense	probably damaging	1.00
R4287:Umodl1	UTSW	17	31,207,039 (GRCm39)	missense	probably benign	0.11
R4452:Umodl1	UTSW	17	31,213,789 (GRCm39)	critical splice donor site	probably null
R4684:Umodl1	UTSW	17	31,217,088 (GRCm39)	missense	probably benign	0.00
R4769:Umodl1	UTSW	17	31,202,976 (GRCm39)	missense	possibly damaging	0.92
R4887:Umodl1	UTSW	17	31,227,639 (GRCm39)	missense	probably benign	0.06
R4888:Umodl1	UTSW	17	31,218,175 (GRCm39)	missense	probably damaging	1.00
R4978:Umodl1	UTSW	17	31,205,055 (GRCm39)	missense	probably benign
R4993:Umodl1	UTSW	17	31,205,459 (GRCm39)	missense	probably benign	0.00
R5241:Umodl1	UTSW	17	31,203,066 (GRCm39)	missense	probably benign	0.18
R5254:Umodl1	UTSW	17	31,199,333 (GRCm39)	missense	possibly damaging	0.86
R5456:Umodl1	UTSW	17	31,201,263 (GRCm39)	missense	probably benign	0.04
R5754:Umodl1	UTSW	17	31,213,761 (GRCm39)	missense	probably damaging	0.96
R6189:Umodl1	UTSW	17	31,215,256 (GRCm39)	missense	possibly damaging	0.75
R6222:Umodl1	UTSW	17	31,221,866 (GRCm39)	critical splice donor site	probably null
R6289:Umodl1	UTSW	17	31,201,325 (GRCm39)	missense	probably benign	0.16
R6432:Umodl1	UTSW	17	31,205,121 (GRCm39)	missense	probably benign	0.38
R6478:Umodl1	UTSW	17	31,178,129 (GRCm39)	missense	probably damaging	1.00
R6702:Umodl1	UTSW	17	31,205,273 (GRCm39)	splice site	probably null
R6822:Umodl1	UTSW	17	31,205,528 (GRCm39)	nonsense	probably null
R6999:Umodl1	UTSW	17	31,218,097 (GRCm39)	missense	probably damaging	1.00
R7067:Umodl1	UTSW	17	31,201,246 (GRCm39)	missense	probably damaging	1.00
R7123:Umodl1	UTSW	17	31,201,318 (GRCm39)	missense	possibly damaging	0.90
R7219:Umodl1	UTSW	17	31,201,236 (GRCm39)	critical splice acceptor site	probably null
R7231:Umodl1	UTSW	17	31,205,090 (GRCm39)	missense	probably damaging	1.00
R7234:Umodl1	UTSW	17	31,205,595 (GRCm39)	missense	possibly damaging	0.87
R7297:Umodl1	UTSW	17	31,227,639 (GRCm39)	missense	probably benign	0.06
R7392:Umodl1	UTSW	17	31,201,306 (GRCm39)	missense	probably damaging	0.99
R7401:Umodl1	UTSW	17	31,217,122 (GRCm39)	missense	probably damaging	1.00
R7461:Umodl1	UTSW	17	31,207,031 (GRCm39)	nonsense	probably null
R7594:Umodl1	UTSW	17	31,173,779 (GRCm39)	missense	probably benign	0.02
R7613:Umodl1	UTSW	17	31,207,031 (GRCm39)	nonsense	probably null
R7763:Umodl1	UTSW	17	31,205,430 (GRCm39)	missense	probably benign	0.24
R7797:Umodl1	UTSW	17	31,178,125 (GRCm39)	missense	probably benign	0.02
R7832:Umodl1	UTSW	17	31,192,666 (GRCm39)	critical splice acceptor site	probably null
R7954:Umodl1	UTSW	17	31,205,361 (GRCm39)	missense	probably benign	0.00
R8088:Umodl1	UTSW	17	31,192,770 (GRCm39)	missense	probably benign	0.29
R8111:Umodl1	UTSW	17	31,190,792 (GRCm39)	missense	probably damaging	0.99
R8314:Umodl1	UTSW	17	31,203,806 (GRCm39)	missense	probably damaging	0.99
R8826:Umodl1	UTSW	17	31,202,958 (GRCm39)	missense	possibly damaging	0.65
R9067:Umodl1	UTSW	17	31,192,677 (GRCm39)	missense	probably damaging	1.00
R9091:Umodl1	UTSW	17	31,185,678 (GRCm39)	missense	probably damaging	1.00
R9099:Umodl1	UTSW	17	31,178,147 (GRCm39)	missense	probably benign	0.01
R9270:Umodl1	UTSW	17	31,185,678 (GRCm39)	missense	probably damaging	1.00
R9341:Umodl1	UTSW	17	31,217,701 (GRCm39)	missense	possibly damaging	0.95
R9343:Umodl1	UTSW	17	31,217,701 (GRCm39)	missense	possibly damaging	0.95
R9400:Umodl1	UTSW	17	31,215,367 (GRCm39)	missense	probably damaging	0.99
R9569:Umodl1	UTSW	17	31,217,143 (GRCm39)	missense	probably damaging	1.00
R9615:Umodl1	UTSW	17	31,217,152 (GRCm39)	missense	possibly damaging	0.94
R9787:Umodl1	UTSW	17	31,178,324 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGGTATGGAGGTGCCCAAC -3'
(R):5'- TTTCTGGCAAGTCTGACGC -3'

Sequencing Primer
(F):5'- TATGGAGGTGCCCAACGTGAC -3'
(R):5'- ACACAGGCTGAGGTTCCAACTG -3'

Posted On

2016-10-06