Incidental Mutation 'R5474:Ncs1'
ID433960
Institutional Source Beutler Lab
Gene Symbol Ncs1
Ensembl Gene ENSMUSG00000062661
Gene Nameneuronal calcium sensor 1
Synonyms9430075O15Rik, Freq, NCS-1, A730032G13Rik
MMRRC Submission 043035-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R5474 (G1)
Quality Score170
Status Not validated
Chromosome2
Chromosomal Location31245823-31295989 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 31280784 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 70 (N70Y)
Ref Sequence ENSEMBL: ENSMUSP00000000199 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000199] [ENSMUST00000150670]
Predicted Effect probably damaging
Transcript: ENSMUST00000000199
AA Change: N70Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000000199
Gene: ENSMUSG00000062661
AA Change: N70Y

DomainStartEndE-ValueType
EFh 64 92 1.9e-2 SMART
EFh 100 128 3.76e-6 SMART
EFh 148 176 3.4e-4 SMART
Predicted Effect silent
Transcript: ENSMUST00000150670
SMART Domains Protein: ENSMUSP00000142269
Gene: ENSMUSG00000062661

DomainStartEndE-ValueType
PDB:4OV2|D 1 28 6e-8 PDB
SCOP:d1fpwa_ 1 28 1e-4 SMART
low complexity region 37 57 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.0%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the neuronal calcium sensor gene family, which encode calcium-binding proteins expressed predominantly in neurons. The protein encoded by this gene regulates G protein-coupled receptor phosphorylation in a calcium-dependent manner and can substitute for calmodulin. The protein is associated with secretory granules and modulates synaptic transmission and synaptic plasticity. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik A T 19: 7,420,159 R24W probably damaging Het
Abcb5 C T 12: 118,940,690 G122S probably null Het
Ankmy1 T C 1: 92,885,204 D461G possibly damaging Het
Ascc3 T C 10: 50,849,538 I2119T probably benign Het
Bud13 G C 9: 46,287,953 R204T probably damaging Het
Clec4a4 T C 6: 123,012,747 S116P probably damaging Het
Cnga1 T C 5: 72,605,193 Y326C probably damaging Het
Cngb1 A T 8: 95,251,969 I588N probably damaging Het
Cspg5 A T 9: 110,251,008 I334F probably damaging Het
Cyp2c29 G A 19: 39,324,992 A350T probably damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Dgkq A G 5: 108,649,143 probably null Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock4 T C 12: 40,745,731 I849T probably benign Het
Drd4 T C 7: 141,293,728 W98R probably damaging Het
Duox1 A T 2: 122,346,625 Q1511L probably benign Het
Gtdc1 A T 2: 44,756,367 L83Q probably damaging Het
H2-T3 G A 17: 36,190,107 P6S probably damaging Het
H6pd A G 4: 149,996,089 C92R probably damaging Het
Ide A G 19: 37,272,184 V923A unknown Het
Kcnc4 A T 3: 107,447,891 S414T possibly damaging Het
Krt14 A T 11: 100,204,745 M278K probably damaging Het
Lrit1 T A 14: 37,061,986 S424T probably benign Het
Muc4 G A 16: 32,761,261 S2500N unknown Het
Nemf C A 12: 69,316,335 R923L probably benign Het
Nrros T C 16: 32,144,352 I246M probably benign Het
Olfr1136 G A 2: 87,693,057 S275F probably damaging Het
Olfr2 T A 7: 107,001,089 Y257F probably damaging Het
Olfr919 T A 9: 38,698,313 T18S possibly damaging Het
Polb A G 8: 22,630,370 Y296H probably benign Het
Prrc2a A T 17: 35,159,213 F440L unknown Het
Prrc2c T C 1: 162,709,644 probably benign Het
Ptprk C T 10: 28,496,930 R726* probably null Het
Rnpc3 A T 3: 113,615,509 L247* probably null Het
Scfd2 C T 5: 74,531,364 V86I probably benign Het
Sec14l5 A G 16: 5,178,518 T443A possibly damaging Het
Slc22a29 A G 19: 8,217,857 V138A probably damaging Het
Usp15 T C 10: 123,128,045 D524G probably damaging Het
Vav3 A G 3: 109,664,421 T220A probably benign Het
Vmn2r17 G A 5: 109,434,284 S513N probably damaging Het
Zfp84 C T 7: 29,777,089 S402L probably damaging Het
Other mutations in Ncs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02021:Ncs1 APN 2 31284165 missense probably damaging 1.00
R1245:Ncs1 UTSW 2 31284693 missense probably benign 0.23
R2853:Ncs1 UTSW 2 31287317 missense probably damaging 0.98
R2983:Ncs1 UTSW 2 31284696 missense probably damaging 1.00
R5813:Ncs1 UTSW 2 31280654 splice site probably null
R6662:Ncs1 UTSW 2 31287360 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGCTTTCCTGGGTCTCAC -3'
(R):5'- TCAGTCATACAGATGAGCACATG -3'

Sequencing Primer
(F):5'- TTCCTGGGTCTCACTGGCAG -3'
(R):5'- TGTGCCACACGTATGCAC -3'
Posted On2016-10-06