Incidental Mutation 'R5474:Cspg5'
ID433978
Institutional Source Beutler Lab
Gene Symbol Cspg5
Ensembl Gene ENSMUSG00000032482
Gene Namechondroitin sulfate proteoglycan 5
SynonymsCALEB, neuroglycan C, NGC
MMRRC Submission 043035-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.224) question?
Stock #R5474 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location110243783-110262576 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110251008 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 334 (I334F)
Ref Sequence ENSEMBL: ENSMUSP00000142845 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035058] [ENSMUST00000196060] [ENSMUST00000197850] [ENSMUST00000199736]
Predicted Effect probably damaging
Transcript: ENSMUST00000035058
AA Change: I415F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000035058
Gene: ENSMUSG00000032482
AA Change: I415F

DomainStartEndE-ValueType
low complexity region 4 31 N/A INTRINSIC
Pfam:Chon_Sulph_att 33 278 2.5e-123 PFAM
low complexity region 290 302 N/A INTRINSIC
EGF 373 413 1.99e1 SMART
transmembrane domain 421 443 N/A INTRINSIC
Pfam:Neural_ProG_Cyt 447 565 5.8e-73 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000196060
AA Change: I415F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143164
Gene: ENSMUSG00000032482
AA Change: I415F

DomainStartEndE-ValueType
Pfam:Chon_Sulph_att 31 278 1e-126 PFAM
low complexity region 290 302 N/A INTRINSIC
EGF 373 413 1.99e1 SMART
transmembrane domain 421 443 N/A INTRINSIC
Pfam:Neural_ProG_Cyt 447 487 8.9e-26 PFAM
Pfam:Neural_ProG_Cyt 486 539 1.3e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196176
Predicted Effect probably damaging
Transcript: ENSMUST00000197850
AA Change: I415F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000143005
Gene: ENSMUSG00000032482
AA Change: I415F

DomainStartEndE-ValueType
Pfam:Chon_Sulph_att 31 278 1.1e-126 PFAM
low complexity region 290 302 N/A INTRINSIC
EGF 373 413 1.99e1 SMART
transmembrane domain 421 443 N/A INTRINSIC
Pfam:Neural_ProG_Cyt 447 520 1.5e-45 PFAM
low complexity region 524 539 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000199736
AA Change: I334F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142845
Gene: ENSMUSG00000032482
AA Change: I334F

DomainStartEndE-ValueType
Pfam:Chon_Sulph_att 1 197 1.6e-99 PFAM
low complexity region 209 221 N/A INTRINSIC
EGF 292 332 9.5e-2 SMART
transmembrane domain 340 362 N/A INTRINSIC
Pfam:Neural_ProG_Cyt 366 406 1.2e-22 PFAM
Pfam:Neural_ProG_Cyt 405 458 1.7e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200140
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.0%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a chondroitin sulfate proteoglycan. The encoded protein has been termed a 'part-time' proteoglycan, as chondroitin sulfate chains appear to be attached to the protein in the developing but not the adult cerebellum and retina. It is thought that this protein plays roles in dendrite branching and synapse formation. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mice display decreased spontaneous postsynaptic currents, increased paired-pulse ratios, and reduced long term depression during early postnatal developmental stages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik A T 19: 7,420,159 R24W probably damaging Het
Abcb5 C T 12: 118,940,690 G122S probably null Het
Ankmy1 T C 1: 92,885,204 D461G possibly damaging Het
Ascc3 T C 10: 50,849,538 I2119T probably benign Het
Bud13 G C 9: 46,287,953 R204T probably damaging Het
Clec4a4 T C 6: 123,012,747 S116P probably damaging Het
Cnga1 T C 5: 72,605,193 Y326C probably damaging Het
Cngb1 A T 8: 95,251,969 I588N probably damaging Het
Cyp2c29 G A 19: 39,324,992 A350T probably damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Dgkq A G 5: 108,649,143 probably null Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock4 T C 12: 40,745,731 I849T probably benign Het
Drd4 T C 7: 141,293,728 W98R probably damaging Het
Duox1 A T 2: 122,346,625 Q1511L probably benign Het
Gtdc1 A T 2: 44,756,367 L83Q probably damaging Het
H2-T3 G A 17: 36,190,107 P6S probably damaging Het
H6pd A G 4: 149,996,089 C92R probably damaging Het
Ide A G 19: 37,272,184 V923A unknown Het
Kcnc4 A T 3: 107,447,891 S414T possibly damaging Het
Krt14 A T 11: 100,204,745 M278K probably damaging Het
Lrit1 T A 14: 37,061,986 S424T probably benign Het
Muc4 G A 16: 32,761,261 S2500N unknown Het
Ncs1 A T 2: 31,280,784 N70Y probably damaging Het
Nemf C A 12: 69,316,335 R923L probably benign Het
Nrros T C 16: 32,144,352 I246M probably benign Het
Olfr1136 G A 2: 87,693,057 S275F probably damaging Het
Olfr2 T A 7: 107,001,089 Y257F probably damaging Het
Olfr919 T A 9: 38,698,313 T18S possibly damaging Het
Polb A G 8: 22,630,370 Y296H probably benign Het
Prrc2a A T 17: 35,159,213 F440L unknown Het
Prrc2c T C 1: 162,709,644 probably benign Het
Ptprk C T 10: 28,496,930 R726* probably null Het
Rnpc3 A T 3: 113,615,509 L247* probably null Het
Scfd2 C T 5: 74,531,364 V86I probably benign Het
Sec14l5 A G 16: 5,178,518 T443A possibly damaging Het
Slc22a29 A G 19: 8,217,857 V138A probably damaging Het
Usp15 T C 10: 123,128,045 D524G probably damaging Het
Vav3 A G 3: 109,664,421 T220A probably benign Het
Vmn2r17 G A 5: 109,434,284 S513N probably damaging Het
Zfp84 C T 7: 29,777,089 S402L probably damaging Het
Other mutations in Cspg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Cspg5 APN 9 110256168 missense probably damaging 1.00
IGL01516:Cspg5 APN 9 110246693 missense probably benign 0.37
IGL01800:Cspg5 APN 9 110251150 splice site probably benign
IGL01927:Cspg5 APN 9 110262084 missense probably damaging 0.99
IGL02164:Cspg5 APN 9 110251036 missense probably damaging 0.98
IGL02338:Cspg5 APN 9 110256267 missense probably benign 0.04
IGL02421:Cspg5 APN 9 110247392 critical splice donor site probably benign
R0106:Cspg5 UTSW 9 110246532 missense probably damaging 0.96
R0540:Cspg5 UTSW 9 110247392 critical splice donor site probably null
R0905:Cspg5 UTSW 9 110246526 missense probably damaging 0.99
R1772:Cspg5 UTSW 9 110262138 missense probably damaging 1.00
R1959:Cspg5 UTSW 9 110251026 missense probably damaging 1.00
R4356:Cspg5 UTSW 9 110256177 missense probably damaging 1.00
R4771:Cspg5 UTSW 9 110251127 missense probably damaging 1.00
R5345:Cspg5 UTSW 9 110246630 missense probably benign 0.03
R5441:Cspg5 UTSW 9 110246643 missense probably benign
R5946:Cspg5 UTSW 9 110251083 missense probably damaging 0.99
R6890:Cspg5 UTSW 9 110246784 missense probably damaging 0.98
R7028:Cspg5 UTSW 9 110246891 missense possibly damaging 0.85
R7286:Cspg5 UTSW 9 110246955 missense probably damaging 1.00
R7697:Cspg5 UTSW 9 110256226 missense probably damaging 0.99
R7858:Cspg5 UTSW 9 110251066 missense probably damaging 1.00
X0020:Cspg5 UTSW 9 110247173 missense probably damaging 0.96
Z1176:Cspg5 UTSW 9 110251050 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGAGGTCTGTTCAGACTGG -3'
(R):5'- AACTTTTAGCATGAGCCAAAGG -3'

Sequencing Primer
(F):5'- CTGTTCAGACTGGGGCTGC -3'
(R):5'- CTAGAGAACAGGTGCCAGACC -3'
Posted On2016-10-06