Incidental Mutation 'R5474:Drd4'
ID433973
Institutional Source Beutler Lab
Gene Symbol Drd4
Ensembl Gene ENSMUSG00000025496
Gene Namedopamine receptor D4
SynonymsD4R, Drd-4
MMRRC Submission 043035-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock #R5474 (G1)
Quality Score193
Status Not validated
Chromosome7
Chromosomal Location141292006-141296464 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141293728 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 98 (W98R)
Ref Sequence ENSEMBL: ENSMUSP00000026569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026569] [ENSMUST00000080553] [ENSMUST00000211146]
Predicted Effect probably damaging
Transcript: ENSMUST00000026569
AA Change: W98R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000026569
Gene: ENSMUSG00000025496
AA Change: W98R

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 40 182 9.6e-9 PFAM
Pfam:7tm_1 48 368 1.8e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000080553
SMART Domains Protein: ENSMUSP00000079395
Gene: ENSMUSG00000058886

DomainStartEndE-ValueType
SCOP:d1gkub1 6 35 9e-3 SMART
low complexity region 43 68 N/A INTRINSIC
low complexity region 88 105 N/A INTRINSIC
low complexity region 167 186 N/A INTRINSIC
SAND 202 274 9.78e-40 SMART
low complexity region 277 286 N/A INTRINSIC
low complexity region 324 338 N/A INTRINSIC
Pfam:zf-MYND 505 541 8.9e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000209600
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209649
Predicted Effect probably benign
Transcript: ENSMUST00000210062
Predicted Effect probably benign
Transcript: ENSMUST00000211146
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.0%
  • 20x: 90.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the D4 subtype of the dopamine receptor. The D4 subtype is a G-protein coupled receptor which inhibits adenylyl cyclase. It is a target for drugs which treat schizophrenia and Parkinson disease. Mutations in this gene have been associated with various behavioral phenotypes, including autonomic nervous system dysfunction, attention deficit/hyperactivity disorder, and the personality trait of novelty seeking. This gene contains a polymorphic number (2-10 copies) of tandem 48 nt repeats; the sequence shown contains four repeats. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants are less active in open field tests and have reduced responses to novelty. However, mice exhibit locomotor supersensitivity to ethanol, cocaine, and methamphetamine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700081O15Rik A T 19: 7,420,159 R24W probably damaging Het
Abcb5 C T 12: 118,940,690 G122S probably null Het
Ankmy1 T C 1: 92,885,204 D461G possibly damaging Het
Ascc3 T C 10: 50,849,538 I2119T probably benign Het
Bud13 G C 9: 46,287,953 R204T probably damaging Het
Clec4a4 T C 6: 123,012,747 S116P probably damaging Het
Cnga1 T C 5: 72,605,193 Y326C probably damaging Het
Cngb1 A T 8: 95,251,969 I588N probably damaging Het
Cspg5 A T 9: 110,251,008 I334F probably damaging Het
Cyp2c29 G A 19: 39,324,992 A350T probably damaging Het
D5Ertd579e G T 5: 36,615,257 S598Y probably damaging Het
Dgkq A G 5: 108,649,143 probably null Het
Dnah2 C T 11: 69,458,920 R2399Q probably benign Het
Dock4 T C 12: 40,745,731 I849T probably benign Het
Duox1 A T 2: 122,346,625 Q1511L probably benign Het
Gtdc1 A T 2: 44,756,367 L83Q probably damaging Het
H2-T3 G A 17: 36,190,107 P6S probably damaging Het
H6pd A G 4: 149,996,089 C92R probably damaging Het
Ide A G 19: 37,272,184 V923A unknown Het
Kcnc4 A T 3: 107,447,891 S414T possibly damaging Het
Krt14 A T 11: 100,204,745 M278K probably damaging Het
Lrit1 T A 14: 37,061,986 S424T probably benign Het
Muc4 G A 16: 32,761,261 S2500N unknown Het
Ncs1 A T 2: 31,280,784 N70Y probably damaging Het
Nemf C A 12: 69,316,335 R923L probably benign Het
Nrros T C 16: 32,144,352 I246M probably benign Het
Olfr1136 G A 2: 87,693,057 S275F probably damaging Het
Olfr2 T A 7: 107,001,089 Y257F probably damaging Het
Olfr919 T A 9: 38,698,313 T18S possibly damaging Het
Polb A G 8: 22,630,370 Y296H probably benign Het
Prrc2a A T 17: 35,159,213 F440L unknown Het
Prrc2c T C 1: 162,709,644 probably benign Het
Ptprk C T 10: 28,496,930 R726* probably null Het
Rnpc3 A T 3: 113,615,509 L247* probably null Het
Scfd2 C T 5: 74,531,364 V86I probably benign Het
Sec14l5 A G 16: 5,178,518 T443A possibly damaging Het
Slc22a29 A G 19: 8,217,857 V138A probably damaging Het
Usp15 T C 10: 123,128,045 D524G probably damaging Het
Vav3 A G 3: 109,664,421 T220A probably benign Het
Vmn2r17 G A 5: 109,434,284 S513N probably damaging Het
Zfp84 C T 7: 29,777,089 S402L probably damaging Het
Other mutations in Drd4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Drd4 APN 7 141292183 missense probably damaging 1.00
IGL01542:Drd4 APN 7 141293831 unclassified probably benign
R2314:Drd4 UTSW 7 141293941 missense probably damaging 1.00
R2484:Drd4 UTSW 7 141294736 missense probably benign
R3054:Drd4 UTSW 7 141294479 missense probably damaging 0.99
R3055:Drd4 UTSW 7 141294479 missense probably damaging 0.99
R3108:Drd4 UTSW 7 141292282 missense possibly damaging 0.95
R3109:Drd4 UTSW 7 141292282 missense possibly damaging 0.95
R4597:Drd4 UTSW 7 141294479 missense probably damaging 0.99
R4964:Drd4 UTSW 7 141293777 missense probably damaging 1.00
R4966:Drd4 UTSW 7 141293777 missense probably damaging 1.00
R6010:Drd4 UTSW 7 141294796 missense probably damaging 1.00
R6480:Drd4 UTSW 7 141294793 missense possibly damaging 0.71
R7206:Drd4 UTSW 7 141292119 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- ACACATGTCTCAGGCTCAC -3'
(R):5'- GCACATCATTGAGGCCACAC -3'

Sequencing Primer
(F):5'- ACATGTCTCAGGCTCACATCGG -3'
(R):5'- TTGAGGCCACACACCACTGG -3'
Posted On2016-10-06