Incidental Mutation 'R5535:Elmo2'
ID434763
Institutional Source Beutler Lab
Gene Symbol Elmo2
Ensembl Gene ENSMUSG00000017670
Gene Nameengulfment and cell motility 2
SynonymsCED-12, 1190002F24Rik
MMRRC Submission 043093-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R5535 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location165288031-165326479 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 165310212 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 163 (V163A)
Ref Sequence ENSEMBL: ENSMUSP00000099380 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071699] [ENSMUST00000074046] [ENSMUST00000094329] [ENSMUST00000103088] [ENSMUST00000103091] [ENSMUST00000126318] [ENSMUST00000133205]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071699
AA Change: V163A

PolyPhen 2 Score 0.515 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000071619
Gene: ENSMUSG00000017670
AA Change: V163A

DomainStartEndE-ValueType
Pfam:DUF3361 115 272 1.6e-61 PFAM
Pfam:ELMO_CED12 295 474 3.2e-39 PFAM
Pfam:PH_12 541 657 5.4e-33 PFAM
internal_repeat_1 670 688 6.69e-7 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000074046
AA Change: V163A

PolyPhen 2 Score 0.515 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000073691
Gene: ENSMUSG00000017670
AA Change: V163A

DomainStartEndE-ValueType
Pfam:DUF3361 114 285 2.7e-75 PFAM
Pfam:ELMO_CED12 304 487 3.7e-48 PFAM
PDB:3A98|D 535 729 3e-99 PDB
SCOP:d1mai__ 552 677 4e-33 SMART
Blast:PH 560 681 2e-82 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000094329
AA Change: V163A

PolyPhen 2 Score 0.515 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000091887
Gene: ENSMUSG00000017670
AA Change: V163A

DomainStartEndE-ValueType
Pfam:DUF3361 114 273 5.6e-77 PFAM
Pfam:ELMO_CED12 292 475 3.6e-48 PFAM
PDB:3A98|D 523 717 2e-99 PDB
SCOP:d1mai__ 540 665 5e-33 SMART
Blast:PH 548 669 1e-82 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000103088
AA Change: V163A

PolyPhen 2 Score 0.515 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099377
Gene: ENSMUSG00000017670
AA Change: V163A

DomainStartEndE-ValueType
Pfam:DUF3361 114 273 6.6e-77 PFAM
Pfam:ELMO_CED12 292 475 4.3e-48 PFAM
internal_repeat_1 654 672 6.69e-7 PROSPERO
internal_repeat_1 670 688 6.69e-7 PROSPERO
Predicted Effect possibly damaging
Transcript: ENSMUST00000103091
AA Change: V163A

PolyPhen 2 Score 0.515 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000099380
Gene: ENSMUSG00000017670
AA Change: V163A

DomainStartEndE-ValueType
Pfam:DUF3361 114 273 5.6e-77 PFAM
Pfam:ELMO_CED12 292 475 3.6e-48 PFAM
PDB:3A98|D 523 717 2e-99 PDB
SCOP:d1mai__ 540 665 5e-33 SMART
Blast:PH 548 669 1e-82 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000126318
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127496
Predicted Effect probably benign
Transcript: ENSMUST00000133205
Predicted Effect unknown
Transcript: ENSMUST00000137188
AA Change: V62A
SMART Domains Protein: ENSMUSP00000123232
Gene: ENSMUSG00000017670
AA Change: V62A

DomainStartEndE-ValueType
Pfam:DUF3361 17 172 1.6e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149844
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with the dedicator of cyto-kinesis 1 protein. Similarity to a C. elegans protein suggests that this protein may function in phagocytosis of apoptotic cells and in cell migration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b C T 9: 119,148,406 G403S probably damaging Het
Agbl2 G A 2: 90,810,006 V699I probably benign Het
Amer2 AAGGAGGAGGAGGAG AAGGAGGAGGAG 14: 60,378,853 probably benign Het
Bace2 A T 16: 97,413,425 Q271L probably damaging Het
Btn2a2 T C 13: 23,478,275 K493E probably benign Het
Ces3a T A 8: 105,051,564 D222E probably benign Het
Ckap2l A G 2: 129,285,842 C139R probably benign Het
Clip4 A G 17: 71,831,262 H485R probably benign Het
Cntfr T A 4: 41,663,216 D197V probably benign Het
Efcab5 A G 11: 77,151,921 L2P probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Flrt2 A G 12: 95,780,426 T513A probably benign Het
Gm10801 GT GTTTTT 2: 98,662,499 probably null Het
Hectd1 A T 12: 51,802,326 F332I probably damaging Het
Helz A G 11: 107,646,120 D947G probably damaging Het
Hivep2 T A 10: 14,131,022 D1121E probably benign Het
Hoxa13 GG GGCG 6: 52,260,540 probably null Homo
Hoxd13 A T 2: 74,668,797 Y163F probably damaging Het
Immt C A 6: 71,852,784 P158Q probably null Het
Kcnh5 A G 12: 75,130,907 S142P possibly damaging Het
Lnpep T G 17: 17,538,694 H796P probably benign Het
Mfhas1 C A 8: 35,590,269 R633S possibly damaging Het
Mmp25 A G 17: 23,644,760 L32P probably benign Het
Myo15b A G 11: 115,881,301 D299G probably damaging Het
Myo18b T C 5: 112,790,042 E1739G probably damaging Het
Olfr907 T A 9: 38,498,998 S110T probably benign Het
Parp9 A G 16: 35,956,825 K147E probably damaging Het
Pcdha3 G T 18: 36,947,936 R577L probably benign Het
Plod2 T A 9: 92,606,569 I637N probably damaging Het
Polk T G 13: 96,495,497 S243R probably damaging Het
Prag1 T C 8: 36,104,014 S584P probably benign Het
Prex1 A T 2: 166,580,273 V43E possibly damaging Het
Rdh10 T C 1: 16,131,184 Y294H probably damaging Het
Rnf126 T A 10: 79,762,699 I28F probably damaging Het
Sdk2 T A 11: 113,943,158 H66L possibly damaging Het
Tet1 G T 10: 62,832,907 P1431Q probably damaging Het
Tmco2 T A 4: 121,105,993 Q103L possibly damaging Het
Ucp3 A T 7: 100,480,666 R172W probably benign Het
Unc79 A T 12: 103,169,703 I2270F possibly damaging Het
Other mutations in Elmo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00796:Elmo2 APN 2 165292014 unclassified probably benign
IGL01096:Elmo2 APN 2 165296987 unclassified probably benign
IGL01694:Elmo2 APN 2 165314773 missense probably benign 0.05
IGL02016:Elmo2 APN 2 165295012 critical splice donor site probably null
IGL02402:Elmo2 APN 2 165297392 missense probably damaging 0.97
IGL02808:Elmo2 APN 2 165291707 unclassified probably benign
IGL03030:Elmo2 APN 2 165294317 missense possibly damaging 0.93
IGL03117:Elmo2 APN 2 165298653 missense probably benign 0.01
R0046:Elmo2 UTSW 2 165298726 missense probably damaging 0.97
R0046:Elmo2 UTSW 2 165298726 missense probably damaging 0.97
R0278:Elmo2 UTSW 2 165297367 missense probably damaging 1.00
R0281:Elmo2 UTSW 2 165296890 missense probably damaging 1.00
R0472:Elmo2 UTSW 2 165298330 missense probably damaging 0.99
R0570:Elmo2 UTSW 2 165304919 missense probably benign 0.38
R1799:Elmo2 UTSW 2 165292157 missense probably damaging 1.00
R1940:Elmo2 UTSW 2 165292050 unclassified probably benign
R2005:Elmo2 UTSW 2 165298279 missense probably benign 0.00
R2504:Elmo2 UTSW 2 165298687 missense probably damaging 0.96
R2915:Elmo2 UTSW 2 165297653 unclassified probably benign
R3744:Elmo2 UTSW 2 165316002 missense probably damaging 0.96
R4027:Elmo2 UTSW 2 165294249 nonsense probably null
R4419:Elmo2 UTSW 2 165311755 splice site probably null
R4824:Elmo2 UTSW 2 165292002 unclassified probably benign
R4888:Elmo2 UTSW 2 165295289 missense probably benign 0.14
R4950:Elmo2 UTSW 2 165314813 splice site probably null
R5157:Elmo2 UTSW 2 165291707 unclassified probably benign
R5682:Elmo2 UTSW 2 165297410 missense probably damaging 1.00
R5840:Elmo2 UTSW 2 165295552 missense possibly damaging 0.64
R5868:Elmo2 UTSW 2 165294272 missense possibly damaging 0.89
R7022:Elmo2 UTSW 2 165295041 missense probably damaging 0.99
R7089:Elmo2 UTSW 2 165304929 missense possibly damaging 0.78
R7678:Elmo2 UTSW 2 165291744 missense unknown
R8024:Elmo2 UTSW 2 165291855 missense unknown
R8290:Elmo2 UTSW 2 165309003 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTGCATAAACCTTTCAGGAGTC -3'
(R):5'- TAGTGTAAGGACCTGGGCTG -3'

Sequencing Primer
(F):5'- AGTCCTGGGAAGATCGCC -3'
(R):5'- TAAGGACCTGGGCTGTGTCC -3'
Posted On2016-10-24