Incidental Mutation 'R5535:Ucp3'
ID 434771
Institutional Source Beutler Lab
Gene Symbol Ucp3
Ensembl Gene ENSMUSG00000032942
Gene Name uncoupling protein 3 (mitochondrial, proton carrier)
Synonyms UCP-3, Slc25a9
MMRRC Submission 043093-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.054) question?
Stock # R5535 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 100472990-100486432 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 100480666 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Tryptophan at position 172 (R172W)
Ref Sequence ENSEMBL: ENSMUSP00000102674 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032958] [ENSMUST00000107059]
AlphaFold P56501
Predicted Effect probably benign
Transcript: ENSMUST00000032958
AA Change: R172W

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000032958
Gene: ENSMUSG00000032942
AA Change: R172W

DomainStartEndE-ValueType
Pfam:Mito_carr 10 107 3.1e-20 PFAM
Pfam:Mito_carr 109 207 9.6e-26 PFAM
Pfam:Mito_carr 210 301 2.7e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107059
AA Change: R172W

PolyPhen 2 Score 0.447 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102674
Gene: ENSMUSG00000032942
AA Change: R172W

DomainStartEndE-ValueType
Pfam:Mito_carr 9 107 5.9e-22 PFAM
Pfam:Mito_carr 109 207 1.7e-27 PFAM
Pfam:Mito_carr 209 301 9.4e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128044
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133850
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.3%
  • 20x: 97.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial uncoupling proteins (UCP) are members of the larger family of mitochondrial anion carrier proteins (MACP). UCPs separate oxidative phosphorylation from ATP synthesis with energy dissipated as heat, also referred to as the mitochondrial proton leak. UCPs facilitate the transfer of anions from the inner to the outer mitochondrial membrane and the return transfer of protons from the outer to the inner mitochondrial membrane. They also reduce the mitochondrial membrane potential in mammalian cells. The different UCPs have tissue-specific expression; this gene is primarily expressed in skeletal muscle. This gene's protein product is postulated to protect mitochondria against lipid-induced oxidative stress. Expression levels of this gene increase when fatty acid supplies to mitochondria exceed their oxidation capacity and the protein enables the export of fatty acids from mitochondria. UCPs contain the three solcar protein domains typically found in MACPs. Two splice variants have been found for this gene.[provided by RefSeq, Nov 2008]
PHENOTYPE: Homozygous null mutants exhibit a lack of superoxide-induced uncoupling in skeletal muscle mitochondria, accompanied by increased reactive oxygen species formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaa1b C T 9: 119,148,406 G403S probably damaging Het
Agbl2 G A 2: 90,810,006 V699I probably benign Het
Amer2 AAGGAGGAGGAGGAG AAGGAGGAGGAG 14: 60,378,853 probably benign Het
Bace2 A T 16: 97,413,425 Q271L probably damaging Het
Btn2a2 T C 13: 23,478,275 K493E probably benign Het
Ces3a T A 8: 105,051,564 D222E probably benign Het
Ckap2l A G 2: 129,285,842 C139R probably benign Het
Clip4 A G 17: 71,831,262 H485R probably benign Het
Cntfr T A 4: 41,663,216 D197V probably benign Het
Efcab5 A G 11: 77,151,921 L2P probably damaging Het
Elmo2 A G 2: 165,310,212 V163A possibly damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Flrt2 A G 12: 95,780,426 T513A probably benign Het
Gm10801 GT GTTTTT 2: 98,662,499 probably null Het
Hectd1 A T 12: 51,802,326 F332I probably damaging Het
Helz A G 11: 107,646,120 D947G probably damaging Het
Hivep2 T A 10: 14,131,022 D1121E probably benign Het
Hoxa13 GG GGCG 6: 52,260,540 probably null Homo
Hoxd13 A T 2: 74,668,797 Y163F probably damaging Het
Immt C A 6: 71,852,784 P158Q probably null Het
Kcnh5 A G 12: 75,130,907 S142P possibly damaging Het
Lnpep T G 17: 17,538,694 H796P probably benign Het
Mfhas1 C A 8: 35,590,269 R633S possibly damaging Het
Mmp25 A G 17: 23,644,760 L32P probably benign Het
Myo15b A G 11: 115,881,301 D299G probably damaging Het
Myo18b T C 5: 112,790,042 E1739G probably damaging Het
Olfr907 T A 9: 38,498,998 S110T probably benign Het
Parp9 A G 16: 35,956,825 K147E probably damaging Het
Pcdha3 G T 18: 36,947,936 R577L probably benign Het
Plod2 T A 9: 92,606,569 I637N probably damaging Het
Polk T G 13: 96,495,497 S243R probably damaging Het
Prag1 T C 8: 36,104,014 S584P probably benign Het
Prex1 A T 2: 166,580,273 V43E possibly damaging Het
Rdh10 T C 1: 16,131,184 Y294H probably damaging Het
Rnf126 T A 10: 79,762,699 I28F probably damaging Het
Sdk2 T A 11: 113,943,158 H66L possibly damaging Het
Tet1 G T 10: 62,832,907 P1431Q probably damaging Het
Tmco2 T A 4: 121,105,993 Q103L possibly damaging Het
Unc79 A T 12: 103,169,703 I2270F possibly damaging Het
Other mutations in Ucp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02016:Ucp3 APN 7 100480559 missense probably damaging 1.00
IGL02883:Ucp3 APN 7 100480642 missense probably benign 0.00
IGL03137:Ucp3 APN 7 100482762 splice site probably benign
PIT4576001:Ucp3 UTSW 7 100480251 missense probably benign 0.04
R0023:Ucp3 UTSW 7 100485043 missense probably benign 0.00
R0023:Ucp3 UTSW 7 100485043 missense probably benign 0.00
R0532:Ucp3 UTSW 7 100481979 splice site probably benign
R0616:Ucp3 UTSW 7 100480161 missense probably benign 0.00
R0833:Ucp3 UTSW 7 100479541 nonsense probably null
R1739:Ucp3 UTSW 7 100482720 missense probably benign 0.01
R1939:Ucp3 UTSW 7 100480664 missense probably benign 0.00
R3861:Ucp3 UTSW 7 100480251 missense probably benign 0.04
R3958:Ucp3 UTSW 7 100482739 missense probably benign 0.00
R3959:Ucp3 UTSW 7 100482739 missense probably benign 0.00
R4059:Ucp3 UTSW 7 100482664 missense probably damaging 0.99
R6463:Ucp3 UTSW 7 100480269 missense probably benign 0.00
R6596:Ucp3 UTSW 7 100481933 missense probably benign 0.01
R7517:Ucp3 UTSW 7 100481882 missense probably damaging 1.00
R7693:Ucp3 UTSW 7 100482592 missense probably benign 0.00
R9487:Ucp3 UTSW 7 100481916 missense probably damaging 1.00
R9493:Ucp3 UTSW 7 100482704 missense probably benign 0.00
Z1177:Ucp3 UTSW 7 100480592 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- CACTGGTGAGATTCTGACAGTG -3'
(R):5'- TTGGACACTATTTGACGTCCTG -3'

Sequencing Primer
(F):5'- GACAGTGTCAGAGACTCCTAGTTC -3'
(R):5'- ACTATTTGACGTCCTGTGGCCAG -3'
Posted On 2016-10-24