Incidental Mutation 'R0006:Cfap61'
ID43620
Institutional Source Beutler Lab
Gene Symbol Cfap61
Ensembl Gene ENSMUSG00000037143
Gene Namecilia and flagella associated protein 61
Synonyms4930529M08Rik
MMRRC Submission 041980-MU
Accession Numbers

Genbank: NM_175280.3; Ensemble: ENSMUST00000133433

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0006 (G1)
Quality Score221
Status Validated
Chromosome2
Chromosomal Location145934784-146215039 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 146077312 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 655 (V655I)
Ref Sequence ENSEMBL: ENSMUSP00000118411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000125223] [ENSMUST00000133433]
Predicted Effect probably benign
Transcript: ENSMUST00000125223
AA Change: V48I

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000121560
Gene: ENSMUSG00000037143
AA Change: V48I

DomainStartEndE-ValueType
low complexity region 54 65 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133433
AA Change: V655I

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000118411
Gene: ENSMUSG00000037143
AA Change: V655I

DomainStartEndE-ValueType
Pfam:DUF4821 15 272 1.1e-96 PFAM
low complexity region 355 368 N/A INTRINSIC
low complexity region 661 672 N/A INTRINSIC
low complexity region 1172 1182 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144066
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150771
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155214
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.3%
Validation Efficiency 97% (67/69)
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aebp1 A G 11: 5,863,935 probably benign Het
Aldh3a1 G A 11: 61,217,101 V324M probably damaging Het
Als2cl T A 9: 110,894,618 L694Q possibly damaging Het
Appl2 A G 10: 83,602,898 F556L probably damaging Het
Atad2b T A 12: 4,942,030 S210T possibly damaging Het
Aurka A G 2: 172,359,753 probably null Het
Boc C T 16: 44,496,449 V444I probably benign Het
Ccdc109b A C 3: 129,933,765 probably benign Het
Chd8 A G 14: 52,235,293 I351T possibly damaging Het
Chid1 T A 7: 141,496,426 probably benign Het
Cyp3a41a T A 5: 145,704,796 H288L probably benign Het
Dnase2b T A 3: 146,582,489 I284F probably damaging Het
Dock2 A G 11: 34,312,453 probably benign Het
Dst C T 1: 34,228,918 T5325I probably benign Het
Erbb3 A G 10: 128,573,410 probably null Het
Fam129c A G 8: 71,605,044 probably benign Het
Fancl A G 11: 26,469,695 N316S possibly damaging Het
Farsa G T 8: 84,861,305 probably benign Het
Fibcd1 T G 2: 31,838,587 D86A probably damaging Het
Gab1 A T 8: 80,769,730 M617K possibly damaging Het
Gabrd C A 4: 155,388,601 V72L probably damaging Het
Ggh C A 4: 20,054,155 T150K possibly damaging Het
Gm340 A G 19: 41,584,899 T698A probably benign Het
Gnb3 G A 6: 124,835,804 probably benign Het
Hephl1 T A 9: 15,076,764 T683S probably benign Het
Hmcn1 G A 1: 150,808,676 P381L probably damaging Het
Hspa8 T G 9: 40,804,629 N544K probably benign Het
Hspg2 C T 4: 137,519,931 T1155I probably damaging Het
Igdcc4 C T 9: 65,135,100 probably benign Het
Jazf1 A G 6: 52,894,086 probably benign Het
Kntc1 T A 5: 123,789,138 S1219T probably benign Het
L3mbtl1 A T 2: 162,964,569 Y460F possibly damaging Het
Lyrm7 T A 11: 54,848,597 T76S probably benign Het
Map1b C T 13: 99,435,302 V304M probably damaging Het
Muc13 T C 16: 33,803,148 S271P probably damaging Het
Myo16 A G 8: 10,475,988 K843E probably damaging Het
Nav2 A G 7: 49,453,230 E531G possibly damaging Het
Nup188 T C 2: 30,322,023 V553A probably benign Het
Olfr1 A G 11: 73,395,488 F178S probably damaging Het
Olfr1348 A G 7: 6,501,611 I205T possibly damaging Het
Olfr376 A G 11: 73,375,588 M283V possibly damaging Het
Olfr646 A G 7: 104,106,320 I14V probably benign Het
Olfr877 T A 9: 37,855,220 V134D possibly damaging Het
P4ha3 C T 7: 100,318,948 R378* probably null Het
Rap1gds1 G T 3: 138,983,871 probably null Het
Rbfox1 T A 16: 7,330,420 S244R probably benign Het
Rpp40 G A 13: 35,896,735 P339S probably damaging Het
Rsph4a T C 10: 33,909,148 C148R probably damaging Het
Skint5 T C 4: 113,893,862 probably benign Het
Sptbn1 A G 11: 30,123,855 S1405P probably damaging Het
Tex35 T C 1: 157,099,744 K154E possibly damaging Het
Thada T C 17: 84,226,040 N1661S probably benign Het
Tle4 A G 19: 14,466,714 probably benign Het
Tnxb T C 17: 34,682,292 S1027P probably benign Het
Tpm3 T A 3: 90,087,661 probably benign Het
Ubr4 T C 4: 139,431,649 F2438L probably benign Het
Uggt2 A T 14: 119,049,663 F640L probably benign Het
Vmn1r20 T G 6: 57,432,305 H205Q probably damaging Het
Wbp2 T C 11: 116,079,788 probably null Het
Xirp1 T C 9: 120,017,454 I788V probably benign Het
Zc3hav1 A G 6: 38,319,702 probably null Het
Zfp687 A G 3: 95,011,456 I335T probably damaging Het
Zfpm1 A G 8: 122,334,488 Y264C probably damaging Het
Other mutations in Cfap61
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02838:Cfap61 APN 2 145947164 nonsense probably null
IGL03024:Cfap61 APN 2 145939999 splice site probably benign
1mM(1):Cfap61 UTSW 2 146200760 missense probably damaging 1.00
R0396:Cfap61 UTSW 2 145949944 missense possibly damaging 0.88
R0458:Cfap61 UTSW 2 146008917 missense probably benign 0.08
R0477:Cfap61 UTSW 2 145939916 missense probably damaging 1.00
R0513:Cfap61 UTSW 2 146035295 missense possibly damaging 0.93
R1104:Cfap61 UTSW 2 145951061 nonsense probably null
R1413:Cfap61 UTSW 2 145963443 missense probably benign 0.27
R1591:Cfap61 UTSW 2 146145458 missense probably benign 0.17
R1599:Cfap61 UTSW 2 146012163 missense probably benign
R1661:Cfap61 UTSW 2 146035319 splice site probably null
R1665:Cfap61 UTSW 2 146035319 splice site probably null
R1789:Cfap61 UTSW 2 145939993 critical splice donor site probably null
R1800:Cfap61 UTSW 2 146042622 missense probably damaging 1.00
R2050:Cfap61 UTSW 2 146145473 missense probably benign 0.26
R2202:Cfap61 UTSW 2 146214680 missense probably damaging 1.00
R2220:Cfap61 UTSW 2 146036816 critical splice acceptor site probably null
R2444:Cfap61 UTSW 2 146035319 splice site probably null
R3779:Cfap61 UTSW 2 145950794 missense probably damaging 1.00
R4668:Cfap61 UTSW 2 146143136 missense probably damaging 0.99
R4705:Cfap61 UTSW 2 146035202 missense probably damaging 1.00
R4763:Cfap61 UTSW 2 146017367 missense probably benign 0.00
R4816:Cfap61 UTSW 2 146143100 missense probably damaging 1.00
R5067:Cfap61 UTSW 2 146102036 missense probably damaging 0.99
R5120:Cfap61 UTSW 2 146143160 nonsense probably null
R5308:Cfap61 UTSW 2 146109988 missense probably damaging 0.99
R5575:Cfap61 UTSW 2 146017393 missense probably benign 0.31
R5834:Cfap61 UTSW 2 146129149 missense probably benign 0.29
R5959:Cfap61 UTSW 2 145947133 missense probably benign 0.00
R6190:Cfap61 UTSW 2 145947133 missense probably benign 0.00
R6283:Cfap61 UTSW 2 146129102 unclassified probably null
R6786:Cfap61 UTSW 2 146045443 missense possibly damaging 0.84
R6933:Cfap61 UTSW 2 145951050 splice site probably null
R7071:Cfap61 UTSW 2 146001912 missense probably benign 0.02
R7132:Cfap61 UTSW 2 146109950 missense probably damaging 0.97
R7312:Cfap61 UTSW 2 146045470 nonsense probably null
R7390:Cfap61 UTSW 2 146001882 missense probably benign 0.00
R7446:Cfap61 UTSW 2 146153838 missense probably benign 0.00
R7515:Cfap61 UTSW 2 146042725 missense unknown
R7608:Cfap61 UTSW 2 145963531 missense possibly damaging 0.73
R7609:Cfap61 UTSW 2 146112533 missense unknown
R7780:Cfap61 UTSW 2 146153772 missense possibly damaging 0.77
R7908:Cfap61 UTSW 2 146102099 missense probably damaging 1.00
R7989:Cfap61 UTSW 2 146102099 missense probably damaging 1.00
R8054:Cfap61 UTSW 2 145973518 missense probably damaging 1.00
R8153:Cfap61 UTSW 2 146200784 missense probably benign 0.26
R8195:Cfap61 UTSW 2 145947175 missense probably benign
R8224:Cfap61 UTSW 2 145939880 missense probably benign
X0022:Cfap61 UTSW 2 146129090 missense probably benign 0.28
Z1088:Cfap61 UTSW 2 146129227 missense probably benign 0.27
Z1177:Cfap61 UTSW 2 146012162 missense possibly damaging 0.77
Z1177:Cfap61 UTSW 2 146153800 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCATTATCGGGGCTTGATTTCC -3'
(R):5'- TGCTGAGGTCCTCAAATGTGCAAC -3'

Sequencing Primer
(F):5'- CCTACAGGGGGTTGGCTTAATAAC -3'
(R):5'- CTCTGCAATGGGTTGTCAAAC -3'
Posted On2013-05-29