Incidental Mutation 'R1413:Cfap61'
ID159670
Institutional Source Beutler Lab
Gene Symbol Cfap61
Ensembl Gene ENSMUSG00000037143
Gene Namecilia and flagella associated protein 61
Synonyms4930529M08Rik
MMRRC Submission 039469-MU
Accession Numbers

Genbank: NM_175280.3; Ensemble: ENSMUST00000133433

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1413 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location145934784-146215039 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 145963443 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 154 (S154T)
Ref Sequence ENSEMBL: ENSMUSP00000120838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000116398] [ENSMUST00000126415] [ENSMUST00000130168] [ENSMUST00000133433] [ENSMUST00000138774] [ENSMUST00000152515]
Predicted Effect probably benign
Transcript: ENSMUST00000116398
AA Change: S238T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000112099
Gene: ENSMUSG00000037143
AA Change: S238T

DomainStartEndE-ValueType
SCOP:d1b87a_ 183 237 1e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126415
SMART Domains Protein: ENSMUSP00000118626
Gene: ENSMUSG00000037143

DomainStartEndE-ValueType
SCOP:d1b87a_ 183 244 1e-5 SMART
low complexity region 355 368 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130168
SMART Domains Protein: ENSMUSP00000121294
Gene: ENSMUSG00000037143

DomainStartEndE-ValueType
transmembrane domain 133 155 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133433
SMART Domains Protein: ENSMUSP00000118411
Gene: ENSMUSG00000037143

DomainStartEndE-ValueType
Pfam:DUF4821 15 272 1.1e-96 PFAM
low complexity region 355 368 N/A INTRINSIC
low complexity region 661 672 N/A INTRINSIC
low complexity region 1172 1182 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138774
AA Change: S154T

PolyPhen 2 Score 0.270 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000120838
Gene: ENSMUSG00000037143
AA Change: S154T

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
transmembrane domain 49 71 N/A INTRINSIC
SCOP:d1b87a_ 99 153 2e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152515
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.7%
  • 20x: 91.2%
Validation Efficiency
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 A G 6: 142,590,496 V1504A probably damaging Het
Abcc9 T C 6: 142,627,519 N1051D possibly damaging Het
Actr6 A T 10: 89,728,157 Y84* probably null Het
Adgrl3 T C 5: 81,693,519 Y816H probably damaging Het
Ahcyl2 T C 6: 29,768,587 probably benign Het
Amd1 A T 10: 40,290,408 C157* probably null Het
Ank1 G A 8: 23,119,377 E1362K probably damaging Het
Atp10b A G 11: 43,230,564 Q1018R probably benign Het
Atp1a2 G A 1: 172,279,344 T803I probably damaging Het
Atr T G 9: 95,932,442 L2064R probably damaging Het
Bmp3 T A 5: 98,872,405 L229Q probably damaging Het
Ccl25 A G 8: 4,353,892 *54W probably null Het
Cdc45 A T 16: 18,808,741 N111K possibly damaging Het
Cyp2c37 T A 19: 39,994,098 S127T probably benign Het
Cyp4f40 T A 17: 32,673,939 D309E probably benign Het
D6Ertd527e A G 6: 87,111,353 D166G unknown Het
Dmbt1 T A 7: 131,050,214 D395E probably damaging Het
Dnah5 A G 15: 28,370,409 S2832G probably benign Het
Dync1h1 G A 12: 110,636,509 E2195K probably benign Het
Fah T C 7: 84,593,212 D296G probably damaging Het
Fam83g A G 11: 61,702,678 N346S probably damaging Het
Fgl1 T A 8: 41,191,601 T289S possibly damaging Het
Fmo1 A C 1: 162,833,862 L284R probably damaging Het
Frem3 T A 8: 80,668,801 M1819K probably benign Het
Fsip2 T A 2: 82,988,418 L4832M possibly damaging Het
Fut1 T C 7: 45,619,428 W269R probably damaging Het
Ggnbp2 A G 11: 84,833,129 Y638H probably damaging Het
Gp2 T A 7: 119,451,630 I293F probably benign Het
Gpi1 T C 7: 34,230,155 N20S probably benign Het
Gxylt1 C T 15: 93,254,392 R222H probably damaging Het
Hemgn T C 4: 46,396,091 K382E possibly damaging Het
Hook3 T A 8: 26,038,106 E585D probably damaging Het
Irf6 G A 1: 193,169,305 M401I probably benign Het
Jmjd1c A G 10: 67,249,750 T2259A probably damaging Het
Lactb T A 9: 66,970,919 R209S probably damaging Het
Lonp2 A G 8: 86,641,584 D342G probably damaging Het
Mmachc T C 4: 116,705,997 S54G probably damaging Het
Mpp7 C A 18: 7,350,977 W573C probably damaging Het
Olfr1133 T A 2: 87,645,838 Y95F probably benign Het
Olfr1415 A T 1: 92,490,888 I289N probably damaging Het
Olfr70 T A 4: 43,697,011 H54L possibly damaging Het
Pappa2 A T 1: 158,936,554 D462E probably benign Het
Pcdh12 A T 18: 38,283,443 F210I probably damaging Het
Ppp1r12c A G 7: 4,484,444 probably null Het
Prkce T A 17: 86,496,018 D448E possibly damaging Het
Ptprb C A 10: 116,339,679 T1193K probably damaging Het
Qrfpr T A 3: 36,182,660 E197D possibly damaging Het
Rusc2 T A 4: 43,416,568 C625S probably benign Het
Shcbp1 T G 8: 4,741,968 probably null Het
Snrnp40 C G 4: 130,378,043 probably null Het
Spag5 T A 11: 78,305,317 C449* probably null Het
Stpg3 T C 2: 25,213,850 D158G probably damaging Het
Sycp2 T C 2: 178,347,797 Y1423C probably benign Het
Tiprl C T 1: 165,215,790 E256K possibly damaging Het
Tmem132c T A 5: 127,563,567 V934D probably damaging Het
Topors A G 4: 40,261,982 V434A probably benign Het
Usp11 A G X: 20,718,707 Y731C probably damaging Het
Vmn2r58 T A 7: 41,863,963 I419L probably benign Het
Wfs1 C A 5: 36,982,078 R72L possibly damaging Het
Zan T C 5: 137,427,939 D2525G unknown Het
Zfp280c A G X: 48,563,838 V285A probably benign Het
Zfp511 T A 7: 140,037,615 F177I probably damaging Het
Zfp964 A G 8: 69,663,070 M107V unknown Het
Zmynd11 A G 13: 9,710,220 Y122H probably damaging Het
Other mutations in Cfap61
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02838:Cfap61 APN 2 145947164 nonsense probably null
IGL03024:Cfap61 APN 2 145939999 splice site probably benign
1mM(1):Cfap61 UTSW 2 146200760 missense probably damaging 1.00
R0006:Cfap61 UTSW 2 146077312 missense probably benign 0.06
R0396:Cfap61 UTSW 2 145949944 missense possibly damaging 0.88
R0458:Cfap61 UTSW 2 146008917 missense probably benign 0.08
R0477:Cfap61 UTSW 2 145939916 missense probably damaging 1.00
R0513:Cfap61 UTSW 2 146035295 missense possibly damaging 0.93
R1104:Cfap61 UTSW 2 145951061 nonsense probably null
R1591:Cfap61 UTSW 2 146145458 missense probably benign 0.17
R1599:Cfap61 UTSW 2 146012163 missense probably benign
R1661:Cfap61 UTSW 2 146035319 splice site probably null
R1665:Cfap61 UTSW 2 146035319 splice site probably null
R1789:Cfap61 UTSW 2 145939993 critical splice donor site probably null
R1800:Cfap61 UTSW 2 146042622 missense probably damaging 1.00
R2050:Cfap61 UTSW 2 146145473 missense probably benign 0.26
R2202:Cfap61 UTSW 2 146214680 missense probably damaging 1.00
R2220:Cfap61 UTSW 2 146036816 critical splice acceptor site probably null
R2444:Cfap61 UTSW 2 146035319 splice site probably null
R3779:Cfap61 UTSW 2 145950794 missense probably damaging 1.00
R4668:Cfap61 UTSW 2 146143136 missense probably damaging 0.99
R4705:Cfap61 UTSW 2 146035202 missense probably damaging 1.00
R4763:Cfap61 UTSW 2 146017367 missense probably benign 0.00
R4816:Cfap61 UTSW 2 146143100 missense probably damaging 1.00
R5067:Cfap61 UTSW 2 146102036 missense probably damaging 0.99
R5120:Cfap61 UTSW 2 146143160 nonsense probably null
R5308:Cfap61 UTSW 2 146109988 missense probably damaging 0.99
R5575:Cfap61 UTSW 2 146017393 missense probably benign 0.31
R5834:Cfap61 UTSW 2 146129149 missense probably benign 0.29
R5959:Cfap61 UTSW 2 145947133 missense probably benign 0.00
R6190:Cfap61 UTSW 2 145947133 missense probably benign 0.00
R6283:Cfap61 UTSW 2 146129102 unclassified probably null
R6786:Cfap61 UTSW 2 146045443 missense possibly damaging 0.84
R6933:Cfap61 UTSW 2 145951050 splice site probably null
R7071:Cfap61 UTSW 2 146001912 missense probably benign 0.02
R7132:Cfap61 UTSW 2 146109950 missense probably damaging 0.97
R7312:Cfap61 UTSW 2 146045470 nonsense probably null
R7390:Cfap61 UTSW 2 146001882 missense probably benign 0.00
R7446:Cfap61 UTSW 2 146153838 missense probably benign 0.00
R7515:Cfap61 UTSW 2 146042725 missense unknown
R7608:Cfap61 UTSW 2 145963531 missense possibly damaging 0.73
R7609:Cfap61 UTSW 2 146112533 missense unknown
R7780:Cfap61 UTSW 2 146153772 missense possibly damaging 0.77
R7908:Cfap61 UTSW 2 146102099 missense probably damaging 1.00
R7989:Cfap61 UTSW 2 146102099 missense probably damaging 1.00
R8054:Cfap61 UTSW 2 145973518 missense probably damaging 1.00
X0022:Cfap61 UTSW 2 146129090 missense probably benign 0.28
Z1088:Cfap61 UTSW 2 146129227 missense probably benign 0.27
Z1177:Cfap61 UTSW 2 146012162 missense possibly damaging 0.77
Z1177:Cfap61 UTSW 2 146153800 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAGCAAACCCTAAACTGAAGGC -3'
(R):5'- GGCATTACCTAGAAGGGTGTGCAG -3'

Sequencing Primer
(F):5'- CTTTCTGTTTCACAGGGTAGAAGAC -3'
(R):5'- gaaaggtgaacaggaagtagaaag -3'
Posted On2014-03-14