Incidental Mutation 'R5642:Inpp5b'
ID440732
Institutional Source Beutler Lab
Gene Symbol Inpp5b
Ensembl Gene ENSMUSG00000028894
Gene Nameinositol polyphosphate-5-phosphatase B
Synonyms75kDa
MMRRC Submission 043290-MU
Accession Numbers

Ncbi RefSeq: NM_008385.3; MGI:103257

Is this an essential gene? Probably non essential (E-score: 0.250) question?
Stock #R5642 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location124741850-124801511 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 124782436 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 362 (C362S)
Ref Sequence ENSEMBL: ENSMUSP00000139221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094782] [ENSMUST00000184454]
Predicted Effect probably benign
Transcript: ENSMUST00000094782
AA Change: C362S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000092375
Gene: ENSMUSG00000028894
AA Change: C362S

DomainStartEndE-ValueType
Pfam:INPP5B_PH 1 150 4.3e-61 PFAM
low complexity region 206 220 N/A INTRINSIC
IPPc 343 644 6.29e-126 SMART
Blast:RhoGAP 706 732 1e-7 BLAST
Blast:RhoGAP 755 809 2e-24 BLAST
RhoGAP 827 993 6.77e-37 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142652
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145359
Predicted Effect probably benign
Transcript: ENSMUST00000184454
AA Change: C362S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000139221
Gene: ENSMUSG00000028894
AA Change: C362S

DomainStartEndE-ValueType
PDB:2KIG|A 1 156 1e-105 PDB
low complexity region 206 220 N/A INTRINSIC
IPPc 343 644 6.29e-126 SMART
PDB:3QBT|H 645 782 6e-49 PDB
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype Strain: 2159609;2159620
FUNCTION: This gene encodes a member of the inositol polyphosphate-5-phosphatase (INPP5) family. This protein hydrolyzes the 5' phosphate from phosphatidylinositol 4,5-bisphosphate and phosphatidylinositol-1,4,5-trisphosphate, which results in changes to multiple signaling pathways. This protein may be involved in protein trafficking and secretion. Homozygous knockout mice exhibit impaired spermatogenesis and male sterility. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null male mice are infertile with a disruption in spermatogenesis and a defect in adherens junctions processing. [provided by MGI curators]
Allele List at MGI

All alleles(24) : Targeted(6) Gene trapped(18)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,971,831 L388P possibly damaging Het
4930432K21Rik C T 8: 84,167,485 T427I probably damaging Het
4932415D10Rik T A 10: 82,284,483 Q4231L probably damaging Het
Abcc1 A G 16: 14,443,455 E699G probably damaging Het
Ap4e1 T A 2: 127,064,979 V1053D possibly damaging Het
Apobec1 T A 6: 122,581,497 I100F probably damaging Het
Atp6v1g3 G T 1: 138,283,742 K53N probably damaging Het
Bag3 C T 7: 128,546,106 R482W probably damaging Het
Cacna1i A G 15: 80,395,078 T2007A possibly damaging Het
Cd44 T C 2: 102,901,342 D2G probably damaging Het
Cdadc1 T A 14: 59,589,923 I100F possibly damaging Het
Cdh16 A G 8: 104,618,045 F485L probably damaging Het
Cdhr5 T A 7: 141,269,197 K817* probably null Het
Cfap46 G T 7: 139,678,577 P260Q probably damaging Het
Clec11a C T 7: 44,306,408 E72K possibly damaging Het
Cnr2 C A 4: 135,916,765 N51K probably damaging Het
Col3a1 T A 1: 45,331,712 probably benign Het
Cxcr1 G A 1: 74,191,828 T345M probably damaging Het
Cyp2s1 T C 7: 25,816,319 probably null Het
Dalrd3 C T 9: 108,572,290 T474M probably damaging Het
Ddit4 C T 10: 59,951,505 S3N probably benign Het
Ddx41 T C 13: 55,535,895 K108E possibly damaging Het
Ece2 A T 16: 20,643,727 H732L probably benign Het
Etv3 T G 3: 87,536,015 L302R possibly damaging Het
Fam135b A G 15: 71,462,136 S1070P probably damaging Het
Fam160a2 A T 7: 105,389,882 I50N probably damaging Het
Gm11567 T A 11: 99,879,611 I125N unknown Het
Grm3 A G 5: 9,570,536 L236P probably benign Het
Hip1 T A 5: 135,433,085 R97* probably null Het
Hoxa5 T C 6: 52,204,217 Y45C probably damaging Het
Ighg1 T A 12: 113,329,034 H305L probably damaging Het
Kif1c A G 11: 70,708,447 K391E probably benign Het
Klf9 T C 19: 23,141,882 V43A probably benign Het
Krt28 T A 11: 99,374,494 I116F probably damaging Het
Lct A T 1: 128,295,232 D1439E probably damaging Het
Liph G A 16: 21,965,995 T284M possibly damaging Het
Lrrc75b T C 10: 75,557,221 K98R possibly damaging Het
Lypd4 T C 7: 24,865,179 Q178R probably benign Het
Map1a T A 2: 121,306,043 S2209T probably damaging Het
Map3k21 C T 8: 125,938,824 T584I probably benign Het
Map3k6 T C 4: 133,245,544 V338A probably damaging Het
Mapk8ip3 A T 17: 24,903,311 V699E possibly damaging Het
Marc1 A C 1: 184,810,919 S71A probably damaging Het
Nckap1l T C 15: 103,455,025 S53P probably benign Het
Nt5e T C 9: 88,327,687 M1T probably null Het
Nudt22 T C 19: 6,995,528 H64R probably damaging Het
Olfr1048 T C 2: 86,235,932 N294S probably damaging Het
Olfr108 A T 17: 37,445,772 T84S probably damaging Het
Olfr198 A G 16: 59,202,006 L140P probably damaging Het
Olfr314 A T 11: 58,786,828 Y198F probably damaging Het
Olfr322 T C 11: 58,666,399 I280T possibly damaging Het
Olfr690 A T 7: 105,329,565 V209D probably damaging Het
Otogl T C 10: 107,886,552 I314V probably benign Het
Pan2 G T 10: 128,308,100 E106D probably benign Het
Papss1 T A 3: 131,631,804 Y554* probably null Het
Pcnx T C 12: 81,895,029 V67A possibly damaging Het
Pdpk1 A C 17: 24,106,855 Y122* probably null Het
Pkd1l1 A T 11: 8,879,202 N1463K probably damaging Het
Ptgfrn C A 3: 101,043,362 M878I probably damaging Het
Ranbp3 G A 17: 56,710,703 G453E probably benign Het
Rapgef2 T C 3: 79,094,850 D261G probably damaging Het
Reep2 A G 18: 34,846,218 S199G probably benign Het
Rnpep G A 1: 135,277,521 T202I probably damaging Het
Sass6 T A 3: 116,607,496 probably null Het
Sema3e A G 5: 14,162,243 D111G probably damaging Het
Slc29a4 A G 5: 142,711,972 E60G probably damaging Het
Sptlc3 T C 2: 139,546,408 Y107H probably damaging Het
Stx6 T C 1: 155,198,179 I245T probably benign Het
Syne2 T C 12: 75,918,532 S774P probably damaging Het
Tbc1d16 T A 11: 119,158,791 Q293L probably damaging Het
Tbc1d30 T C 10: 121,296,787 D224G probably damaging Het
Tbc1d32 T A 10: 56,150,877 N759Y possibly damaging Het
Tdrd12 G T 7: 35,511,300 A166E probably damaging Het
Tex14 A G 11: 87,514,220 R653G probably benign Het
Them6 A T 15: 74,721,805 R171W probably null Het
Tln2 T C 9: 67,296,358 T489A probably benign Het
Tmem87a A G 2: 120,403,946 F39L probably benign Het
Toporsl T A 4: 52,611,515 C469* probably null Het
Tpr T C 1: 150,423,818 S1147P probably damaging Het
Trp53bp1 T C 2: 121,236,662 M528V probably benign Het
Trpm6 T A 19: 18,830,207 C1039S probably damaging Het
Ttc16 T A 2: 32,775,336 S5C probably damaging Het
Ttn T C 2: 76,787,068 Y14607C probably damaging Het
Usp6nl T C 2: 6,430,464 F345L probably damaging Het
Vmn1r205 C T 13: 22,592,036 G299R probably benign Het
Vmn2r74 G A 7: 85,957,380 H253Y probably benign Het
Vps13d A T 4: 145,170,302 D343E possibly damaging Het
Vwf A G 6: 125,603,418 E543G Het
Wdr92 A G 11: 17,227,263 N207S possibly damaging Het
Zfat A T 15: 68,180,916 V343E probably damaging Het
Zfp316 T C 5: 143,264,091 E139G unknown Het
Zfp943 T A 17: 21,992,832 C300S probably damaging Het
Zkscan16 A G 4: 58,957,748 K677E probably benign Het
Other mutations in Inpp5b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Inpp5b APN 4 124784375 missense possibly damaging 0.94
IGL00696:Inpp5b APN 4 124742535 start codon destroyed probably null 1.00
IGL00969:Inpp5b APN 4 124783994 missense probably damaging 1.00
IGL01401:Inpp5b APN 4 124746087 missense probably damaging 0.97
IGL01481:Inpp5b APN 4 124800699 splice site probably null
IGL01517:Inpp5b APN 4 124782436 missense probably benign 0.00
IGL03085:Inpp5b APN 4 124792322 missense probably benign 0.01
IGL03178:Inpp5b APN 4 124785254 missense probably benign 0.02
reduced UTSW 4 124792252 missense probably damaging 1.00
P0042:Inpp5b UTSW 4 124797910 critical splice donor site probably null
R0504:Inpp5b UTSW 4 124782408 nonsense probably null
R0531:Inpp5b UTSW 4 124795456 missense probably damaging 0.99
R1396:Inpp5b UTSW 4 124789080 missense probably damaging 1.00
R1626:Inpp5b UTSW 4 124783903 missense probably damaging 1.00
R1768:Inpp5b UTSW 4 124793276 nonsense probably null
R2037:Inpp5b UTSW 4 124798299 missense probably damaging 0.98
R2119:Inpp5b UTSW 4 124797869 missense probably benign 0.00
R2132:Inpp5b UTSW 4 124785168 splice site probably benign
R2190:Inpp5b UTSW 4 124785195 missense probably damaging 1.00
R3237:Inpp5b UTSW 4 124780486 missense probably benign 0.04
R3800:Inpp5b UTSW 4 124785345 missense probably damaging 1.00
R4735:Inpp5b UTSW 4 124783967 missense probably damaging 0.99
R4827:Inpp5b UTSW 4 124743850 intron probably benign
R4865:Inpp5b UTSW 4 124751495 missense probably benign
R4868:Inpp5b UTSW 4 124751410 missense probably damaging 0.99
R4913:Inpp5b UTSW 4 124780421 missense probably benign 0.09
R5055:Inpp5b UTSW 4 124743031 critical splice donor site probably null
R5068:Inpp5b UTSW 4 124742649 splice site probably null
R5208:Inpp5b UTSW 4 124751317 missense possibly damaging 0.62
R5875:Inpp5b UTSW 4 124780406 missense possibly damaging 0.66
R6015:Inpp5b UTSW 4 124798350 missense possibly damaging 0.94
R6288:Inpp5b UTSW 4 124785227 missense probably benign 0.00
R6450:Inpp5b UTSW 4 124792252 missense probably damaging 1.00
R7138:Inpp5b UTSW 4 124785272 missense probably damaging 1.00
R7235:Inpp5b UTSW 4 124751392 missense probably benign 0.04
R7382:Inpp5b UTSW 4 124751577 missense probably benign 0.00
R7659:Inpp5b UTSW 4 124795426 missense probably damaging 1.00
R7806:Inpp5b UTSW 4 124785088 splice site probably null
R8509:Inpp5b UTSW 4 124743905 critical splice donor site probably null
Z1176:Inpp5b UTSW 4 124797840 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTTGCAGCTATCGCAAAGGC -3'
(R):5'- ACATTGAACAGAGACACAGCTG -3'

Sequencing Primer
(F):5'- CTATCGCAAAGGCAGACTGTTGATC -3'
(R):5'- AGCTGTCTCTGAGCTGAGC -3'
Posted On2016-11-08