Mutagenetix > Incidental Mutation

Incidental Mutation 'R3745:Zc3h13'

271183

Institutional Source

Beutler Lab

Gene Symbol

Zc3h13

Ensembl Gene

ENSMUSG00000022000

Gene Name

zinc finger CCCH type containing 13

Synonyms

4930570G11Rik, 3110050K21Rik, 2600010B19Rik, C87618

MMRRC Submission

040731-MU

Accession Numbers

Genbank: NM_026083

Is this an essential gene?

Probably essential (E-score: 0.967) question?

Stock #

R3745 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

75284373-75344426 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 75330661 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1131 (D1131E)

Ref Sequence

ENSEMBL: ENSMUSP00000022577 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022577] [ENSMUST00000227049]

AlphaFold

E9Q784

Predicted Effect

probably benign
Transcript: ENSMUST00000022577
AA Change: D1131E

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000022577
Gene: ENSMUSG00000022000
AA Change: D1131E

Domain	Start	End	E-Value	Type
ZnF_C3H1	36	63	4.54e-4	SMART
low complexity region	136	145	N/A	INTRINSIC
coiled coil region	162	197	N/A	INTRINSIC
low complexity region	204	233	N/A	INTRINSIC
low complexity region	261	269	N/A	INTRINSIC
low complexity region	278	287	N/A	INTRINSIC
low complexity region	321	357	N/A	INTRINSIC
low complexity region	411	478	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	496	575	N/A	INTRINSIC
low complexity region	684	701	N/A	INTRINSIC
coiled coil region	706	865	N/A	INTRINSIC
low complexity region	907	918	N/A	INTRINSIC
internal_repeat_1	921	948	1.8e-6	PROSPERO
low complexity region	964	985	N/A	INTRINSIC
low complexity region	1032	1052	N/A	INTRINSIC
low complexity region	1071	1087	N/A	INTRINSIC
low complexity region	1160	1218	N/A	INTRINSIC
low complexity region	1253	1265	N/A	INTRINSIC
internal_repeat_1	1273	1301	1.8e-6	PROSPERO
low complexity region	1325	1349	N/A	INTRINSIC
low complexity region	1366	1391	N/A	INTRINSIC
low complexity region	1400	1425	N/A	INTRINSIC
low complexity region	1431	1442	N/A	INTRINSIC
low complexity region	1690	1697	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000227049
AA Change: D1131E

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

98% (44/45)

Allele List at MGI

All alleles(11) : Targeted, other(2) Gene trapped(9)

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B07Rik	G	T	11: 109,794,154	C172*	probably null	Het
Acot9	G	A	X: 155,271,945		probably benign	Het
Akap10	A	G	11: 61,915,305	V199A	probably benign	Het
Aox4	C	T	1: 58,245,870	H594Y	probably damaging	Het
Arhgap35	A	T	7: 16,563,722	Y473N	probably damaging	Het
Aspn	G	A	13: 49,566,560	E351K	probably damaging	Het
Astn1	G	T	1: 158,502,060	A162S	probably damaging	Het
Auts2	A	G	5: 131,476,587		probably benign	Het
Cog6	A	T	3: 52,992,819	M507K	probably benign	Het
Crct1	C	A	3: 93,014,707		probably benign	Het
Cyp2d11	A	C	15: 82,391,855	I175S	probably benign	Het
Dclk1	A	G	3: 55,247,442	N98D	possibly damaging	Het
Erich5	T	A	15: 34,470,732	C36S	probably damaging	Het
F5	A	G	1: 164,186,779	I540V	possibly damaging	Het
Fam20a	A	T	11: 109,677,790	S303R	probably benign	Het
Fam214a	T	C	9: 75,009,862	V581A	probably benign	Het
Fat3	G	A	9: 15,998,271	S2145F	probably damaging	Het
Gbp9	C	A	5: 105,105,858		probably benign	Het
Gm6408	G	T	5: 146,484,436	V292F	probably damaging	Het
Kmt2a	A	G	9: 44,831,340		probably benign	Het
Lrriq1	T	C	10: 103,170,856	D1136G	probably damaging	Het
Macrod2	C	A	2: 141,810,629	T204K	probably damaging	Het
Mlkl	A	G	8: 111,315,567		probably benign	Het
Msantd1	T	A	5: 34,923,467	V155E	possibly damaging	Het
Myo3b	A	G	2: 70,234,485		probably benign	Het
Nbn	T	A	4: 15,976,163	C375S	possibly damaging	Het
Nell2	A	C	15: 95,432,673	C231W	probably damaging	Het
Nipbl	A	G	15: 8,358,874	S421P	probably benign	Het
Npr3	A	T	15: 11,905,491	V50E	probably damaging	Het
Olfr1425	A	G	19: 12,074,380	L84P	probably damaging	Het
Pclo	T	C	5: 14,678,421		probably benign	Het
Pkn3	A	G	2: 30,090,341	K785R	probably damaging	Het
Ppef2	T	A	5: 92,239,151		probably benign	Het
Prdm10	T	C	9: 31,340,407	I357T	possibly damaging	Het
Prrc2c	G	A	1: 162,698,185	T284I	unknown	Het
Psma3	T	C	12: 70,978,748	S13P	possibly damaging	Het
Ptch1	T	G	13: 63,524,959	E944A	probably benign	Het
Rpl6l	T	C	10: 111,126,365		noncoding transcript	Het
Tex11	A	G	X: 100,916,572	V522A	probably benign	Het
Thsd7b	A	G	1: 129,678,241	E573G	probably benign	Het
Tom1l1	A	G	11: 90,657,741	S259P	probably benign	Het
Trpm8	A	G	1: 88,348,327	E549G	probably benign	Het
Vmn1r66	C	T	7: 10,274,321	A262T	possibly damaging	Het
Zfp445	A	C	9: 122,854,726	D289E	probably benign	Het

Other mutations in Zc3h13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00945:Zc3h13	APN	14	75330147	missense	probably damaging	0.99
IGL01129:Zc3h13	APN	14	75335999	missense	probably damaging	1.00
IGL01599:Zc3h13	APN	14	75309723	missense	probably damaging	1.00
IGL01844:Zc3h13	APN	14	75343769	utr 3 prime	probably benign
IGL02132:Zc3h13	APN	14	75330347	missense	probably benign	0.10
IGL03108:Zc3h13	APN	14	75331766	missense	possibly damaging	0.73
IGL03299:Zc3h13	APN	14	75293941	missense	probably damaging	1.00
IGL03377:Zc3h13	APN	14	75293976	missense	possibly damaging	0.53
B5639:Zc3h13	UTSW	14	75316039	missense	probably damaging	1.00
FR4304:Zc3h13	UTSW	14	75323603	small insertion	probably benign
FR4304:Zc3h13	UTSW	14	75323610	small insertion	probably benign
FR4340:Zc3h13	UTSW	14	75323592	small insertion	probably benign
FR4449:Zc3h13	UTSW	14	75323601	nonsense	probably null
FR4548:Zc3h13	UTSW	14	75323599	small insertion	probably benign
FR4589:Zc3h13	UTSW	14	75323592	small insertion	probably benign
FR4589:Zc3h13	UTSW	14	75323597	small insertion	probably benign
FR4589:Zc3h13	UTSW	14	75323598	small insertion	probably benign
FR4737:Zc3h13	UTSW	14	75323596	small insertion	probably benign
FR4737:Zc3h13	UTSW	14	75323599	small insertion	probably benign
PIT4696001:Zc3h13	UTSW	14	75331883	missense	probably damaging	1.00
R0103:Zc3h13	UTSW	14	75330468	missense	probably damaging	0.98
R0103:Zc3h13	UTSW	14	75330468	missense	probably damaging	0.98
R0127:Zc3h13	UTSW	14	75323254	missense	unknown
R0374:Zc3h13	UTSW	14	75308965	missense	probably damaging	1.00
R0396:Zc3h13	UTSW	14	75323482	missense	unknown
R0408:Zc3h13	UTSW	14	75292186	nonsense	probably null
R0967:Zc3h13	UTSW	14	75343739	missense	possibly damaging	0.54
R1006:Zc3h13	UTSW	14	75330549	missense	probably damaging	0.99
R1142:Zc3h13	UTSW	14	75315984	missense	probably benign	0.14
R1605:Zc3h13	UTSW	14	75337483	nonsense	probably null
R2021:Zc3h13	UTSW	14	75330195	missense	probably damaging	0.96
R2270:Zc3h13	UTSW	14	75332147	missense	probably benign	0.03
R3508:Zc3h13	UTSW	14	75308940	nonsense	probably null
R3954:Zc3h13	UTSW	14	75329738	missense	possibly damaging	0.85
R4205:Zc3h13	UTSW	14	75327601	missense	unknown
R4799:Zc3h13	UTSW	14	75339423	missense	probably damaging	1.00
R5042:Zc3h13	UTSW	14	75339396	missense	probably damaging	0.98
R5133:Zc3h13	UTSW	14	75336009	missense	probably damaging	1.00
R5384:Zc3h13	UTSW	14	75343619	missense	probably benign	0.14
R5432:Zc3h13	UTSW	14	75331247	missense	probably damaging	1.00
R5611:Zc3h13	UTSW	14	75330908	missense	probably benign	0.10
R5687:Zc3h13	UTSW	14	75331960	nonsense	probably null
R5726:Zc3h13	UTSW	14	75330829	missense	possibly damaging	0.84
R5817:Zc3h13	UTSW	14	75328132	missense	probably damaging	0.96
R6087:Zc3h13	UTSW	14	75330709	missense	probably damaging	0.96
R6224:Zc3h13	UTSW	14	75337409	missense	probably damaging	0.99
R6247:Zc3h13	UTSW	14	75343736	missense	probably benign	0.14
R6278:Zc3h13	UTSW	14	75330423	missense	probably benign	0.01
R6315:Zc3h13	UTSW	14	75308915	missense	probably damaging	1.00
R6490:Zc3h13	UTSW	14	75323558	small deletion	probably benign
R6598:Zc3h13	UTSW	14	75332183	missense	probably damaging	0.99
R7051:Zc3h13	UTSW	14	75331157	missense	probably damaging	1.00
R7054:Zc3h13	UTSW	14	75321787	missense	probably benign	0.19
R7135:Zc3h13	UTSW	14	75321721	missense	unknown
R7307:Zc3h13	UTSW	14	75330541	missense	probably damaging	0.96
R7515:Zc3h13	UTSW	14	75308909	missense	unknown
R7680:Zc3h13	UTSW	14	75330515	missense	probably damaging	0.99
R8031:Zc3h13	UTSW	14	75330630	missense	not run
R8048:Zc3h13	UTSW	14	75324537	missense	unknown
R8059:Zc3h13	UTSW	14	75327810	missense	unknown
R8362:Zc3h13	UTSW	14	75324469	missense	unknown
R8391:Zc3h13	UTSW	14	75331185	missense	probably damaging	1.00
R8724:Zc3h13	UTSW	14	75332072	missense	probably benign	0.05
R9081:Zc3h13	UTSW	14	75331941	small deletion	probably benign
R9082:Zc3h13	UTSW	14	75331941	small deletion	probably benign
R9101:Zc3h13	UTSW	14	75323602	missense	unknown
R9214:Zc3h13	UTSW	14	75323551	missense	unknown
R9308:Zc3h13	UTSW	14	75327978	missense	unknown
R9376:Zc3h13	UTSW	14	75323688	missense	unknown
R9618:Zc3h13	UTSW	14	75330102	missense
R9665:Zc3h13	UTSW	14	75330549	missense	probably damaging	0.99
Z1177:Zc3h13	UTSW	14	75328065	missense	unknown

Predicted Primers

PCR Primer
(F):5'- GCAACCTTGAGACACATGAGG -3'
(R):5'- ACTGCCATTGGTATTGGAGG -3'

Sequencing Primer
(F):5'- CCTTGAGACACATGAGGATAGTC -3'
(R):5'- CAGTGGCTGCAGTACTGG -3'

Posted On

2015-03-18