Incidental Mutation 'R5662:Ssc4d'
ID444125
Institutional Source Beutler Lab
Gene Symbol Ssc4d
Ensembl Gene ENSMUSG00000029699
Gene Namescavenger receptor cysteine rich family, 4 domains
SynonymsC330016E03Rik, Srcrb4d
MMRRC Submission 043305-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.206) question?
Stock #R5662 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location135960211-135974531 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 135960894 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Arginine at position 587 (*587R)
Ref Sequence ENSEMBL: ENSMUSP00000106783 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000054895] [ENSMUST00000111150] [ENSMUST00000111152] [ENSMUST00000111153] [ENSMUST00000153823]
Predicted Effect probably null
Transcript: ENSMUST00000054895
AA Change: *135R
SMART Domains Protein: ENSMUSP00000050439
Gene: ENSMUSG00000029699
AA Change: *135R

DomainStartEndE-ValueType
SR 32 132 1.99e-51 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111150
AA Change: *109R
SMART Domains Protein: ENSMUSP00000106780
Gene: ENSMUSG00000029699
AA Change: *109R

DomainStartEndE-ValueType
SR 6 106 1.99e-51 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111152
AA Change: *587R
SMART Domains Protein: ENSMUSP00000106782
Gene: ENSMUSG00000029699
AA Change: *587R

DomainStartEndE-ValueType
low complexity region 40 59 N/A INTRINSIC
SR 69 169 1.44e-48 SMART
SR 200 300 6.78e-54 SMART
low complexity region 301 315 N/A INTRINSIC
SR 355 455 2.04e-48 SMART
SR 484 584 1.99e-51 SMART
Predicted Effect probably null
Transcript: ENSMUST00000111153
AA Change: *587R
SMART Domains Protein: ENSMUSP00000106783
Gene: ENSMUSG00000029699
AA Change: *587R

DomainStartEndE-ValueType
low complexity region 40 59 N/A INTRINSIC
SR 69 169 1.44e-48 SMART
SR 200 300 6.78e-54 SMART
low complexity region 301 315 N/A INTRINSIC
SR 355 455 2.04e-48 SMART
SR 484 584 1.99e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153823
SMART Domains Protein: ENSMUSP00000122958
Gene: ENSMUSG00000029699

DomainStartEndE-ValueType
SR 1 101 6.78e-54 SMART
low complexity region 102 116 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154696
SMART Domains Protein: ENSMUSP00000117071
Gene: ENSMUSG00000029699

DomainStartEndE-ValueType
SR 2 61 5.24e-5 SMART
low complexity region 88 102 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The scavenger receptor cysteine-rich (SRCR) superfamily is an ancient and highly conserved group of cell surface and/or secreted proteins, some of which are involved in the development of the immune system and the regulation of both innate and adaptive immune responses. Group B SRCR domains usually contain 8 regularly spaced cysteines that give rise to a well-defined intradomain disulfide-bond pattern.[supplied by OMIM, Apr 2004]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan T A 7: 79,100,107 V1542D possibly damaging Het
Acsm4 T G 7: 119,694,800 N131K possibly damaging Het
Ankrd54 A G 15: 79,062,614 S62P possibly damaging Het
Ccdc186 A G 19: 56,793,488 I753T probably benign Het
Cers2 C T 3: 95,320,984 R112C probably damaging Het
Col6a4 C G 9: 106,068,001 R971S probably damaging Het
Ctsf T C 19: 4,856,578 S178P probably damaging Het
D430042O09Rik A G 7: 125,842,703 R595G probably benign Het
Dennd4c C T 4: 86,795,288 T492I probably benign Het
Dhx8 A G 11: 101,766,758 K1212E possibly damaging Het
Dnah8 A G 17: 30,737,333 T2096A probably damaging Het
Ephb4 A T 5: 137,372,195 I886F probably damaging Het
Eprs T G 1: 185,394,425 N519K possibly damaging Het
Fam3c T C 6: 22,355,062 probably benign Het
Galnt17 G A 5: 131,086,006 R219C probably damaging Het
Gm10645 A G 8: 83,165,857 probably benign Het
Gpr132 G A 12: 112,852,796 R137C probably damaging Het
Hydin T G 8: 110,580,709 S3907A probably benign Het
Ighv1-49 A T 12: 115,055,407 V56E probably damaging Het
Igtp A G 11: 58,206,279 D92G probably damaging Het
Itga1 C T 13: 114,986,171 V750I probably benign Het
Kif3c T A 12: 3,367,031 Y351N probably damaging Het
Klhdc1 T A 12: 69,283,165 I356N probably benign Het
Lrrc34 T C 3: 30,631,324 Y292C probably benign Het
Ly75 G A 2: 60,352,381 T526M probably damaging Het
Mroh4 A T 15: 74,625,428 D181E possibly damaging Het
Nutm1 T C 2: 112,249,300 N757D probably benign Het
Olfr24 A G 9: 18,755,600 F12L probably damaging Het
Olfr384 T C 11: 73,603,179 F200L probably benign Het
Olfr466 T C 13: 65,152,253 F10L possibly damaging Het
Olfr811 T C 10: 129,802,307 T73A possibly damaging Het
Paxbp1 G A 16: 91,037,397 T167M probably benign Het
Pnpla7 A G 2: 25,052,384 D1238G probably damaging Het
Pom121l2 T C 13: 21,982,188 S210P probably benign Het
Ripor3 T G 2: 167,993,556 N165T probably benign Het
Serpine3 T G 14: 62,670,842 S106R probably benign Het
Slc25a11 G A 11: 70,645,419 R158* probably null Het
Slc26a6 G A 9: 108,859,339 V506M possibly damaging Het
Slc45a2 A G 15: 11,022,083 K304E probably benign Het
Slc4a4 C T 5: 89,028,244 L25F probably damaging Het
Smarcb1 T C 10: 75,904,570 N267S possibly damaging Het
Spink6 C A 18: 44,074,414 Q24K possibly damaging Het
Srebf2 T C 15: 82,195,003 S811P probably benign Het
Sult2a8 C T 7: 14,427,840 R27H probably benign Het
Sun2 C T 15: 79,738,868 A90T probably benign Het
Ubr7 T C 12: 102,768,267 S267P probably benign Het
Wdr55 G A 18: 36,760,395 V37M possibly damaging Het
Xdh C T 17: 73,941,115 G45S probably damaging Het
Zfp638 T A 6: 83,943,129 S570T probably damaging Het
Other mutations in Ssc4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01120:Ssc4d APN 5 135967963 missense probably damaging 1.00
IGL02585:Ssc4d APN 5 135970338 missense possibly damaging 0.74
IGL02821:Ssc4d APN 5 135966069 splice site probably benign
IGL03343:Ssc4d APN 5 135961174 nonsense probably null
R2051:Ssc4d UTSW 5 135970264 missense probably benign 0.00
R2069:Ssc4d UTSW 5 135970317 missense possibly damaging 0.50
R2508:Ssc4d UTSW 5 135965607 missense probably damaging 1.00
R2901:Ssc4d UTSW 5 135964663 missense possibly damaging 0.57
R2902:Ssc4d UTSW 5 135964663 missense possibly damaging 0.57
R2939:Ssc4d UTSW 5 135965724 missense possibly damaging 0.61
R3081:Ssc4d UTSW 5 135965724 missense possibly damaging 0.61
R4038:Ssc4d UTSW 5 135970316 missense possibly damaging 0.50
R4181:Ssc4d UTSW 5 135961924 missense possibly damaging 0.85
R4590:Ssc4d UTSW 5 135964684 missense probably benign 0.00
R4771:Ssc4d UTSW 5 135970220 missense probably damaging 1.00
R5411:Ssc4d UTSW 5 135963400 missense probably benign 0.40
R5583:Ssc4d UTSW 5 135970196 missense probably damaging 0.99
R5681:Ssc4d UTSW 5 135970220 missense probably damaging 1.00
R6357:Ssc4d UTSW 5 135966096 missense probably benign 0.00
R6962:Ssc4d UTSW 5 135962921 critical splice donor site probably null
R7258:Ssc4d UTSW 5 135963087 missense probably damaging 1.00
R7274:Ssc4d UTSW 5 135967956 missense possibly damaging 0.66
R7360:Ssc4d UTSW 5 135966111 missense probably damaging 1.00
R7563:Ssc4d UTSW 5 135963033 missense probably damaging 1.00
Z1177:Ssc4d UTSW 5 135961066 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGTCTCGGGACACACAGTAAG -3'
(R):5'- TGATGATGCCTGGGACCTAC -3'

Sequencing Primer
(F):5'- CACACAGTAAGAGGACTCGGGC -3'
(R):5'- ACCTACGGGCAGCCATTGTC -3'
Posted On2016-11-09