Incidental Mutation 'V8831:Cdc7'
ID44612
Institutional Source Beutler Lab
Gene Symbol Cdc7
Ensembl Gene ENSMUSG00000029283
Gene Namecell division cycle 7 (S. cerevisiae)
SynonymsCdc7, muCdc7, Cdc7l1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #V8831 () of strain 710
Quality Score209
Status Not validated
Chromosome5
Chromosomal Location106964322-106984432 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 106968910 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 50 (N50K)
Ref Sequence ENSEMBL: ENSMUSP00000119612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031221] [ENSMUST00000076467] [ENSMUST00000117196] [ENSMUST00000118261] [ENSMUST00000129938]
Predicted Effect probably benign
Transcript: ENSMUST00000031221
AA Change: N50K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000031221
Gene: ENSMUSG00000029283
AA Change: N50K

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 52 212 1.7e-14 PFAM
Pfam:Pkinase 52 216 4.4e-27 PFAM
Pfam:Pkinase 351 559 1.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000076467
AA Change: N50K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000075792
Gene: ENSMUSG00000029283
AA Change: N50K

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 52 214 1.7e-14 PFAM
Pfam:Pkinase 52 227 1.1e-25 PFAM
Pfam:Pkinase 314 520 2.5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000117196
AA Change: N50K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000112392
Gene: ENSMUSG00000029283
AA Change: N50K

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 52 214 1e-14 PFAM
Pfam:Pkinase 52 227 6.6e-26 PFAM
Pfam:Pkinase 313 527 4.5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118261
AA Change: N50K

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000113385
Gene: ENSMUSG00000029283
AA Change: N50K

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 52 214 1.2e-14 PFAM
Pfam:Pkinase 52 227 7.4e-26 PFAM
Pfam:Pkinase 345 559 5.1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129938
AA Change: N50K

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000119612
Gene: ENSMUSG00000029283
AA Change: N50K

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 52 214 5.4e-15 PFAM
Pfam:Pkinase 52 227 3.4e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140378
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell division cycle protein with kinase activity that is critical for the G1/S transition. The yeast homolog is also essential for initiation of DNA replication as cell division occurs. Overexpression of this gene product may be associated with neoplastic transformation for some tumors. Multiple alternatively spliced transcript variants that encode the same protein have been detected. [provided by RefSeq, Aug 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality between E3.5-E6.5. In conjunction with a Trp53-null allele, double homozygous mutant embryos survive up to E8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahsa1 A G 12: 87,269,923 N107S probably damaging Het
Arhgap23 A G 11: 97,456,545 I690V probably benign Het
Bard1 G A 1: 71,088,217 P78S probably damaging Het
Ccar1 G A 10: 62,747,406 T976I unknown Het
Cep85 C T 4: 134,156,069 E170K possibly damaging Het
Cpsf2 C T 12: 102,003,141 R757C probably damaging Het
Csmd3 A T 15: 48,457,696 D239E probably damaging Het
Dnah7b T G 1: 46,373,298 Y4022* probably null Het
Elmo3 A G 8: 105,307,061 N179S probably benign Het
H2-T24 T A 17: 36,017,324 Q89L probably damaging Het
Hist1h2bj G C 13: 22,043,281 probably benign Het
Irak4 T C 15: 94,561,484 I327T probably damaging Het
Itpr2 A T 6: 146,385,882 L157Q probably damaging Het
Lama1 G A 17: 67,752,883 D656N probably benign Het
Lrrc72 G T 12: 36,208,657 T67K possibly damaging Het
Map2 T G 1: 66,415,845 I1298S probably damaging Het
Mroh2a T TN 1: 88,256,167 probably null Het
Ndst1 G A 18: 60,702,927 A428V probably damaging Het
Obsl1 G A 1: 75,486,756 T1764M probably benign Het
Olfr1369-ps1 T C 13: 21,116,003 Y104H possibly damaging Het
Olfr177 G T 16: 58,873,075 T25K probably benign Het
Olfr481 C T 7: 108,081,535 A247V probably benign Het
Plxna1 A G 6: 89,357,137 V170A probably damaging Het
Rfx6 G A 10: 51,718,208 probably null Het
Shprh G A 10: 11,186,862 D1238N probably damaging Het
Slc15a2 A G 16: 36,772,445 M179T probably benign Het
Slc9c1 A T 16: 45,577,899 I676F possibly damaging Het
Smoc1 A G 12: 81,168,255 D305G probably damaging Het
Spdef C T 17: 27,718,077 R184H probably damaging Het
Stxbp4 C T 11: 90,480,671 A535T probably benign Het
Tcp11l1 C G 2: 104,685,484 V345L probably benign Het
Ticam1 TC T 17: 56,269,969 probably null Het
Ttc28 A T 5: 111,100,712 Y177F probably benign Het
Ugt2b34 A T 5: 86,906,674 Y83N probably benign Het
Vmn2r30 G A 7: 7,334,149 R163C probably benign Het
Xirp1 T G 9: 120,016,907 Q970P probably benign Het
Other mutations in Cdc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00642:Cdc7 APN 5 106968860 missense probably benign
IGL01671:Cdc7 APN 5 106983245 missense probably damaging 1.00
IGL03373:Cdc7 APN 5 106972919 splice site probably benign
R0179:Cdc7 UTSW 5 106965039 missense probably benign 0.02
R0563:Cdc7 UTSW 5 106972910 splice site probably benign
R1621:Cdc7 UTSW 5 106965054 missense probably benign
R1970:Cdc7 UTSW 5 106973074 splice site probably benign
R2044:Cdc7 UTSW 5 106983132 missense probably benign
R2993:Cdc7 UTSW 5 106973898 missense probably benign
R3110:Cdc7 UTSW 5 106974698 critical splice donor site probably null
R3112:Cdc7 UTSW 5 106974698 critical splice donor site probably null
R4700:Cdc7 UTSW 5 106973841 missense probably benign 0.00
R5396:Cdc7 UTSW 5 106969297 splice site probably null
R6217:Cdc7 UTSW 5 106972794 missense probably damaging 1.00
R6258:Cdc7 UTSW 5 106969227 missense probably damaging 1.00
R6285:Cdc7 UTSW 5 106983059 missense probably benign 0.00
R6609:Cdc7 UTSW 5 106973058 missense probably benign 0.04
R7828:Cdc7 UTSW 5 106972950 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- ACCACCTGTCTCACCCAGCTTTA -3'
(R):5'- TGTCCTTCTTGCAACTGTGCTGT -3'

Sequencing Primer
(F):5'- gtttgtttgtttgtttgtttgttttg -3'
(R):5'- GTGCCTATGAAGCAATCAAGC -3'
Posted On2013-06-11