Incidental Mutation 'R5041:Olfr573-ps1'
ID452799
Institutional Source Beutler Lab
Gene Symbol Olfr573-ps1
Ensembl Gene ENSMUSG00000052785
Gene Nameolfactory receptor 573, pseudogene 1
SynonymsMOR10-3P, MOR10-4, GA_x6K02T2PBJ9-5653743-5652872
MMRRC Submission 042631-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R5041 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location102941682-102942575 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 102942578 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147664 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064830] [ENSMUST00000210571]
Predicted Effect probably null
Transcript: ENSMUST00000064830
SMART Domains Protein: ENSMUSP00000065147
Gene: ENSMUSG00000052785

DomainStartEndE-ValueType
Pfam:7tm_4 33 296 9.3e-109 PFAM
Pfam:7tm_1 43 288 4.6e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000064830
Predicted Effect probably null
Transcript: ENSMUST00000210571
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.5%
Validation Efficiency 98% (42/43)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg7 A G 16: 56,730,348 F667S probably benign Het
Akna A G 4: 63,387,144 Y462H possibly damaging Het
Anxa11 G T 14: 25,874,764 E278* probably null Het
Ap3s2 T C 7: 79,920,519 Y20C probably benign Het
Atxn7 T C 14: 14,096,317 probably null Het
AW551984 T C 9: 39,600,598 Y39C probably damaging Het
Becn1 A T 11: 101,288,836 S442T probably benign Het
Bhlhe40 C T 6: 108,662,585 T108I probably damaging Het
Cnst A G 1: 179,605,028 D252G probably damaging Het
Cpxm1 A G 2: 130,394,070 S391P probably damaging Het
Ctnna2 T A 6: 76,915,763 N814Y probably damaging Het
Ddx3y T A Y: 1,266,611 Y282F probably benign Het
Ddx56 A G 11: 6,264,178 V357A probably damaging Het
Frmpd1 T G 4: 45,278,878 C534W probably damaging Het
Gimap8 A G 6: 48,659,163 N621D probably damaging Het
Gm13023 T C 4: 143,793,690 V4A probably benign Het
Herc1 T A 9: 66,429,045 I1624N possibly damaging Het
Htr7 A C 19: 36,057,067 W63G probably benign Het
Ly6g6c T A 17: 35,065,452 probably null Het
Macf1 T C 4: 123,397,046 probably null Het
Mfrp A G 9: 44,102,278 D62G probably damaging Het
Ncam1 T C 9: 49,566,785 Y173C probably damaging Het
Nwd1 T C 8: 72,705,055 V1185A possibly damaging Het
Olfr1218 A T 2: 89,054,921 C168* probably null Het
Papd5 CCCAACAACGCCAACAA CCCAACAA 8: 88,255,250 probably benign Het
Pcf11 G A 7: 92,658,405 P852S probably benign Het
Ralgapa2 T C 2: 146,485,151 I63V probably benign Het
Rsf1 GCGGCGGCG GCGGCGGCGTCGGCGGCG 7: 97,579,925 probably benign Het
Rubcnl T C 14: 75,050,132 F619L probably damaging Het
Sec24d A T 3: 123,294,231 Q247L probably damaging Het
Spns3 G T 11: 72,536,547 Q306K possibly damaging Het
Sstr1 T C 12: 58,213,155 V188A possibly damaging Het
Supt5 A T 7: 28,315,380 L1024Q probably damaging Het
Thegl A G 5: 77,056,081 T319A probably benign Het
Unc13b T A 4: 43,237,836 H3452Q probably benign Het
Usp28 A G 9: 49,037,773 Q864R probably benign Het
Vmn2r43 T C 7: 8,244,807 T786A probably damaging Het
Yy1 TCACCACCACCACCACCACCACCACCACC TCACCACCACCACCACCACCACCACCACCACC 12: 108,793,631 probably benign Het
Other mutations in Olfr573-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0472:Olfr573-ps1 UTSW 7 102942051 nonsense probably null
R1537:Olfr573-ps1 UTSW 7 102942340 missense probably damaging 1.00
R2168:Olfr573-ps1 UTSW 7 102942471 missense probably benign 0.00
R3781:Olfr573-ps1 UTSW 7 102942071 missense probably benign
R4198:Olfr573-ps1 UTSW 7 102941797 missense probably damaging 1.00
R4200:Olfr573-ps1 UTSW 7 102941797 missense probably damaging 1.00
R4333:Olfr573-ps1 UTSW 7 102941969 missense possibly damaging 0.50
R4838:Olfr573-ps1 UTSW 7 102942246 missense probably damaging 1.00
R5371:Olfr573-ps1 UTSW 7 102942512 missense probably benign
R5668:Olfr573-ps1 UTSW 7 102941921 missense probably benign 0.44
R7836:Olfr573-ps1 UTSW 7 102941918 missense possibly damaging 0.94
R7887:Olfr573-ps1 UTSW 7 102942151 missense possibly damaging 0.94
R7919:Olfr573-ps1 UTSW 7 102941918 missense possibly damaging 0.94
R7970:Olfr573-ps1 UTSW 7 102942151 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TCAAAGCCAACATGCAGAGG -3'
(R):5'- CCACCACGTATGAACTGCTAG -3'

Sequencing Primer
(F):5'- GTAGTACATAGGCTCATGGAGG -3'
(R):5'- CCACGTATGAACTGCTAGAAAAAG -3'
Posted On2017-01-06