Incidental Mutation 'IGL03055:Cdhr1'
ID453399
Institutional Source Beutler Lab
Gene Symbol Cdhr1
Ensembl Gene ENSMUSG00000021803
Gene Namecadherin-related family member 1
SynonymsPcdh21, Prcad
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #IGL03055 (G1)
Quality Score142
Status Validated
Chromosome14
Chromosomal Location37077857-37098347 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 37095097 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 102 (D102E)
Ref Sequence ENSEMBL: ENSMUSP00000022337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022337]
Predicted Effect probably benign
Transcript: ENSMUST00000022337
AA Change: D102E

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000022337
Gene: ENSMUSG00000021803
AA Change: D102E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 57 133 9.4e-7 SMART
CA 157 245 9.44e-21 SMART
CA 269 352 2.06e-12 SMART
CA 383 471 2.68e-11 SMART
CA 495 575 5.26e-19 SMART
CA 594 685 1.64e-6 SMART
transmembrane domain 703 725 N/A INTRINSIC
low complexity region 734 745 N/A INTRINSIC
low complexity region 789 799 N/A INTRINSIC
low complexity region 817 829 N/A INTRINSIC
Meta Mutation Damage Score 0.1015 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 98% (58/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the cadherin superfamily of calcium-dependent cell adhesion molecules. The encoded protein is a photoreceptor-specific cadherin that plays a role in outer segment disc morphogenesis. Mutations in this gene are associated with inherited retinal dystrophies. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit progressive degeneration of retinal photoreceptor cells and a slight reduction in light responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900041M22Rik T A 11: 117,612,246 noncoding transcript Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
A430005L14Rik T A 4: 153,960,635 S40R probably benign Het
Aire A G 10: 78,043,069 L48P probably damaging Het
Alkbh8 T C 9: 3,345,882 probably benign Het
Aqp7 A G 4: 41,045,326 M18T probably benign Het
Cchcr1 T A 17: 35,526,619 M406K probably benign Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Clec16a T A 16: 10,741,781 S973T probably damaging Het
Crb1 CG C 1: 139,237,086 probably null Het
Csmd1 A G 8: 16,095,501 Y1471H probably damaging Het
Dnah12 A G 14: 26,872,740 Y3489C probably damaging Het
Ect2 T C 3: 27,137,062 E464G probably damaging Het
Enpp2 C A 15: 54,866,085 probably null Het
Erich2 G T 2: 70,509,185 C28F possibly damaging Het
Fam135b A T 15: 71,622,034 H15Q possibly damaging Het
Fcna G C 2: 25,630,681 probably benign Het
Gfral T A 9: 76,208,549 T48S probably benign Het
Itga10 A G 3: 96,650,520 E293G probably damaging Het
Lrp2 A T 2: 69,458,448 N3691K probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Nefm T C 14: 68,122,909 T371A probably damaging Het
Nkain3 C A 4: 20,778,308 C3F probably benign Het
Nol4l G C 2: 153,436,270 silent Het
Nprl3 C A 11: 32,248,230 probably benign Het
Olfr656 A T 7: 104,618,206 I176F probably damaging Het
Pate2 T C 9: 35,611,773 probably benign Het
Pde4d A G 13: 109,935,345 K128R probably damaging Het
Ptprt A G 2: 161,533,613 L1329P probably damaging Het
Rapgef3 T C 15: 97,749,489 probably benign Het
Rassf5 T C 1: 131,244,995 I46V probably benign Het
Rin1 C T 19: 5,053,159 T481I probably benign Het
Samd4b A G 7: 28,405,546 L524P possibly damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Srebf1 T C 11: 60,207,076 silent Het
Ssh2 C T 11: 77,408,195 Q123* probably null Het
St18 G T 1: 6,802,735 L231F probably damaging Het
Stk11 A C 10: 80,128,086 D96A probably damaging Het
Svil A G 18: 5,108,615 T1918A probably damaging Het
Thrap3 G A 4: 126,165,542 probably null Het
Tlr1 C A 5: 64,926,596 V213F probably benign Het
Trappc10 C T 10: 78,214,686 R307Q probably damaging Het
Ugt1a1 AT A 1: 88,212,371 probably null Het
Wnt6 G A 1: 74,782,854 R198H probably damaging Het
Yipf2 A T 9: 21,589,723 V98E probably benign Het
Zc3h15 A G 2: 83,661,171 T248A possibly damaging Het
Zc3hav1 C T 6: 38,316,316 probably null Het
Zfp697 T G 3: 98,425,494 C79G possibly damaging Het
Other mutations in Cdhr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Cdhr1 APN 14 37085528 missense probably benign 0.06
IGL01820:Cdhr1 APN 14 37085579 missense probably benign 0.11
IGL02469:Cdhr1 APN 14 37085600 missense possibly damaging 0.68
IGL03373:Cdhr1 APN 14 37096300 missense possibly damaging 0.89
PIT4494001:Cdhr1 UTSW 14 37082856 missense probably benign 0.07
R0110:Cdhr1 UTSW 14 37080676 missense probably damaging 0.99
R0219:Cdhr1 UTSW 14 37079601 missense possibly damaging 0.82
R0265:Cdhr1 UTSW 14 37081376 missense probably benign 0.02
R0450:Cdhr1 UTSW 14 37080676 missense probably damaging 0.99
R0510:Cdhr1 UTSW 14 37080676 missense probably damaging 0.99
R0522:Cdhr1 UTSW 14 37094000 critical splice donor site probably null
R0788:Cdhr1 UTSW 14 37087375 critical splice donor site probably null
R0880:Cdhr1 UTSW 14 37080634 missense possibly damaging 0.53
R1209:Cdhr1 UTSW 14 37082942 splice site probably null
R1253:Cdhr1 UTSW 14 37079625 missense probably benign
R1604:Cdhr1 UTSW 14 37095093 missense probably benign 0.29
R1968:Cdhr1 UTSW 14 37079725 missense probably benign 0.00
R2064:Cdhr1 UTSW 14 37095105 missense probably benign 0.10
R2248:Cdhr1 UTSW 14 37081377 missense probably benign
R3843:Cdhr1 UTSW 14 37084927 missense probably benign 0.03
R4178:Cdhr1 UTSW 14 37082939 splice site probably null
R4205:Cdhr1 UTSW 14 37080504 missense probably benign 0.00
R4681:Cdhr1 UTSW 14 37096237 missense probably benign 0.01
R5039:Cdhr1 UTSW 14 37079643 missense probably benign 0.02
R5088:Cdhr1 UTSW 14 37089465 missense probably benign 0.08
R5383:Cdhr1 UTSW 14 37089007 missense possibly damaging 0.94
R5507:Cdhr1 UTSW 14 37082845 missense probably damaging 0.98
R5933:Cdhr1 UTSW 14 37089462 missense probably benign 0.01
R6074:Cdhr1 UTSW 14 37079643 missense probably benign 0.02
R6291:Cdhr1 UTSW 14 37089465 missense probably benign 0.31
R6449:Cdhr1 UTSW 14 37090597 missense probably benign 0.35
R6890:Cdhr1 UTSW 14 37085645 missense probably damaging 1.00
R6891:Cdhr1 UTSW 14 37097377 splice site probably null
R7653:Cdhr1 UTSW 14 37082201 missense probably benign 0.27
R7740:Cdhr1 UTSW 14 37089380 missense probably damaging 0.98
R7805:Cdhr1 UTSW 14 37081545 missense probably benign 0.00
R8081:Cdhr1 UTSW 14 37094010 missense probably benign 0.01
R8147:Cdhr1 UTSW 14 37079652 missense probably benign 0.02
R8164:Cdhr1 UTSW 14 37079542 missense probably damaging 1.00
R8283:Cdhr1 UTSW 14 37082780 missense probably benign 0.00
R8343:Cdhr1 UTSW 14 37091978 missense probably benign 0.00
X0062:Cdhr1 UTSW 14 37079779 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTCTCACTATGCCTCTCAGAC -3'
(R):5'- CTGGACACACAGAGCTTTCC -3'

Sequencing Primer
(F):5'- ACTATGCCTCTCAGACGTGGG -3'
(R):5'- GAGCTTTCCCAGATAAGCTCTCAAG -3'
Posted On2017-02-03