Mutagenetix > Incidental Mutations

Incidental Mutation 'IGL03055:Itga10'

453375

Institutional Source

Beutler Lab

Gene Symbol

Itga10

Ensembl Gene

ENSMUSG00000090210

Gene Name

integrin, alpha 10

Synonyms

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.129) question?

Stock #

IGL03055 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

96645584-96664519 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 96650520 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 293 (E293G)

Ref Sequence

ENSEMBL: ENSMUSP00000029744 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029744] [ENSMUST00000119365] [ENSMUST00000137564]

Predicted Effect

probably damaging
Transcript: ENSMUST00000029744
AA Change: E293G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000029744
Gene: ENSMUSG00000090210
AA Change: E293G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Int_alpha	37	93	9.03e-3	SMART
VWA	165	355	9.6e-43	SMART
Int_alpha	427	481	2.01e0	SMART
Int_alpha	482	539	5.14e-7	SMART
Int_alpha	545	600	5.34e-14	SMART
Int_alpha	607	652	8.75e0	SMART
transmembrane domain	1123	1145	N/A	INTRINSIC
low complexity region	1153	1166	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000119365
AA Change: E293G

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000112393
Gene: ENSMUSG00000090210
AA Change: E293G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Int_alpha	37	93	9.03e-3	SMART
VWA	165	355	9.6e-43	SMART
Int_alpha	427	481	2.01e0	SMART
Int_alpha	482	539	5.14e-7	SMART
Int_alpha	545	600	5.34e-14	SMART
Int_alpha	607	652	8.75e0	SMART
transmembrane domain	1122	1144	N/A	INTRINSIC
low complexity region	1152	1165	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000137564

SMART Domains

Protein: ENSMUSP00000121011
Gene: ENSMUSG00000106447

Domain	Start	End	E-Value	Type
Pfam:PEX11	1	172	4.5e-57	PFAM
low complexity region	186	204	N/A	INTRINSIC
Int_alpha	222	278	9.03e-3	SMART
Blast:VWA	292	345	3e-7	BLAST

Meta Mutation Damage Score

0.3134

Coding Region Coverage

1x: 0.0%
3x: 0.0%
10x: 0.0%
20x: 0.0%

Validation Efficiency

98% (58/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are integral transmembrane glycoproteins composed of noncovalently linked alpha and beta chains. They participate in cell adhesion as well as cell-surface mediated signalling. This gene encodes an integrin alpha chain and is expressed at high levels in chondrocytes, where it is transcriptionally regulated by AP-2epsilon and Ets-1. The protein encoded by this gene binds to collagen. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous null mice display slightly shortened long bones and amild abnormalities in ephysiseal plate morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2900041M22Rik	T	A	11: 117,612,246		noncoding transcript	Het
4933416I08Rik	TCC	TCCC	X: 53,690,895		noncoding transcript	Het
A430005L14Rik	T	A	4: 153,960,635	S40R	probably benign	Het
Aire	A	G	10: 78,043,069	L48P	probably damaging	Het
Alkbh8	T	C	9: 3,345,882		probably benign	Het
Aqp7	A	G	4: 41,045,326	M18T	probably benign	Het
Cchcr1	T	A	17: 35,526,619	M406K	probably benign	Het
Cdhr1	A	T	14: 37,095,097	D102E	probably benign	Het
Cilp	TGGG	TGG	9: 65,280,130		probably null	Het
Clec16a	T	A	16: 10,741,781	S973T	probably damaging	Het
Crb1	CG	C	1: 139,237,086		probably null	Het
Csmd1	A	G	8: 16,095,501	Y1471H	probably damaging	Het
Dnah12	A	G	14: 26,872,740	Y3489C	probably damaging	Het
Ect2	T	C	3: 27,137,062	E464G	probably damaging	Het
Enpp2	C	A	15: 54,866,085		probably null	Het
Erich2	G	T	2: 70,509,185	C28F	possibly damaging	Het
Fam135b	A	T	15: 71,622,034	H15Q	possibly damaging	Het
Fcna	G	C	2: 25,630,681		probably benign	Het
Gfral	T	A	9: 76,208,549	T48S	probably benign	Het
Lrp2	A	T	2: 69,458,448	N3691K	probably damaging	Het
Mmp1a	TG	TGG	9: 7,465,083		probably null	Het
Nefm	T	C	14: 68,122,909	T371A	probably damaging	Het
Nkain3	C	A	4: 20,778,308	C3F	probably benign	Het
Nol4l	G	C	2: 153,436,270		silent	Het
Nprl3	C	A	11: 32,248,230		probably benign	Het
Olfr656	A	T	7: 104,618,206	I176F	probably damaging	Het
Pate2	T	C	9: 35,611,773		probably benign	Het
Pde4d	A	G	13: 109,935,345	K128R	probably damaging	Het
Ptprt	A	G	2: 161,533,613	L1329P	probably damaging	Het
Rapgef3	T	C	15: 97,749,489		probably benign	Het
Rassf5	T	C	1: 131,244,995	I46V	probably benign	Het
Rin1	C	T	19: 5,053,159	T481I	probably benign	Het
Samd4b	A	G	7: 28,405,546	L524P	possibly damaging	Het
Speer4c	A	C	5: 15,714,216		probably benign	Het
Srebf1	T	C	11: 60,207,076		silent	Het
Ssh2	C	T	11: 77,408,195	Q123*	probably null	Het
St18	G	T	1: 6,802,735	L231F	probably damaging	Het
Stk11	A	C	10: 80,128,086	D96A	probably damaging	Het
Svil	A	G	18: 5,108,615	T1918A	probably damaging	Het
Thrap3	G	A	4: 126,165,542		probably null	Het
Tlr1	C	A	5: 64,926,596	V213F	probably benign	Het
Trappc10	C	T	10: 78,214,686	R307Q	probably damaging	Het
Ugt1a1	AT	A	1: 88,212,371		probably null	Het
Wnt6	G	A	1: 74,782,854	R198H	probably damaging	Het
Yipf2	A	T	9: 21,589,723	V98E	probably benign	Het
Zc3h15	A	G	2: 83,661,171	T248A	possibly damaging	Het
Zc3hav1	C	T	6: 38,316,316		probably null	Het
Zfp697	T	G	3: 98,425,494	C79G	possibly damaging	Het

Other mutations in Itga10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01473:Itga10	APN	3	96647641	missense	probably damaging	0.96
IGL01694:Itga10	APN	3	96652517	missense	probably damaging	0.99
IGL01754:Itga10	APN	3	96656775	unclassified	probably benign
IGL02527:Itga10	APN	3	96655624	unclassified	probably benign
IGL02956:Itga10	APN	3	96655113	missense	possibly damaging	0.46
IGL03371:Itga10	APN	3	96654788	missense	possibly damaging	0.84
PIT4515001:Itga10	UTSW	3	96662632	missense	probably damaging	0.99
R0153:Itga10	UTSW	3	96653700	missense	probably benign	0.00
R0308:Itga10	UTSW	3	96651464	missense	probably damaging	1.00
R0331:Itga10	UTSW	3	96652483	missense	probably damaging	1.00
R0413:Itga10	UTSW	3	96649059	missense	probably damaging	1.00
R0437:Itga10	UTSW	3	96649137	missense	probably damaging	1.00
R0511:Itga10	UTSW	3	96658174	missense	probably damaging	1.00
R0630:Itga10	UTSW	3	96656299	unclassified	probably benign
R0844:Itga10	UTSW	3	96651738	splice site	probably benign
R0849:Itga10	UTSW	3	96652530	missense	possibly damaging	0.67
R0894:Itga10	UTSW	3	96653660	missense	possibly damaging	0.69
R0919:Itga10	UTSW	3	96651738	splice site	probably benign
R1027:Itga10	UTSW	3	96651738	splice site	probably benign
R1341:Itga10	UTSW	3	96652495	missense	probably damaging	1.00
R1350:Itga10	UTSW	3	96657477	missense	probably benign	0.01
R1370:Itga10	UTSW	3	96651738	splice site	probably benign
R1467:Itga10	UTSW	3	96652229	nonsense	probably null
R1467:Itga10	UTSW	3	96652229	nonsense	probably null
R1589:Itga10	UTSW	3	96651738	splice site	probably benign
R1590:Itga10	UTSW	3	96651738	splice site	probably benign
R1601:Itga10	UTSW	3	96653658	missense	possibly damaging	0.82
R1659:Itga10	UTSW	3	96662977	missense	probably damaging	0.96
R1665:Itga10	UTSW	3	96651738	splice site	probably benign
R1667:Itga10	UTSW	3	96651738	splice site	probably benign
R1686:Itga10	UTSW	3	96651825	missense	probably damaging	0.97
R1972:Itga10	UTSW	3	96651738	splice site	probably benign
R1976:Itga10	UTSW	3	96651738	splice site	probably benign
R2020:Itga10	UTSW	3	96652490	missense	probably damaging	1.00
R2040:Itga10	UTSW	3	96651738	splice site	probably benign
R2044:Itga10	UTSW	3	96651738	splice site	probably benign
R2044:Itga10	UTSW	3	96657690	missense	probably benign
R2045:Itga10	UTSW	3	96651738	splice site	probably benign
R2060:Itga10	UTSW	3	96654998	nonsense	probably null
R2146:Itga10	UTSW	3	96651492	missense	possibly damaging	0.59
R2146:Itga10	UTSW	3	96653723	missense	probably damaging	1.00
R2170:Itga10	UTSW	3	96650457	missense	probably damaging	1.00
R2893:Itga10	UTSW	3	96655100	missense	probably benign	0.11
R2926:Itga10	UTSW	3	96652849	missense	probably damaging	1.00
R3622:Itga10	UTSW	3	96651738	splice site	probably benign
R3623:Itga10	UTSW	3	96651738	splice site	probably benign
R4416:Itga10	UTSW	3	96658246	missense	possibly damaging	0.58
R4633:Itga10	UTSW	3	96647704	missense	possibly damaging	0.92
R5074:Itga10	UTSW	3	96652211	nonsense	probably null
R5095:Itga10	UTSW	3	96648164	missense	probably benign	0.21
R5495:Itga10	UTSW	3	96647371	missense	possibly damaging	0.92
R5813:Itga10	UTSW	3	96652585	missense	probably benign	0.38
R6114:Itga10	UTSW	3	96649035	missense	probably damaging	1.00
R6172:Itga10	UTSW	3	96647437	missense	probably benign	0.18
R6275:Itga10	UTSW	3	96658185	missense	probably benign	0.36
R6298:Itga10	UTSW	3	96656762	missense	probably benign	0.00
R6433:Itga10	UTSW	3	96658041	critical splice donor site	probably null
R6841:Itga10	UTSW	3	96656714	missense	probably damaging	1.00
R6909:Itga10	UTSW	3	96662599	missense	probably benign	0.00
R6927:Itga10	UTSW	3	96656714	missense	probably damaging	1.00
R7124:Itga10	UTSW	3	96651765	missense	probably damaging	0.96
R7310:Itga10	UTSW	3	96648159	missense	probably damaging	1.00
R7387:Itga10	UTSW	3	96652778	missense	probably benign	0.11
R7464:Itga10	UTSW	3	96648155	missense	probably damaging	1.00
R7624:Itga10	UTSW	3	96652953	missense	probably benign
R7638:Itga10	UTSW	3	96657391	splice site	probably null
R7639:Itga10	UTSW	3	96649582	missense	probably benign	0.36
R7893:Itga10	UTSW	3	96649612	missense	probably damaging	1.00
R8297:Itga10	UTSW	3	96654800	missense	probably damaging	1.00
R8753:Itga10	UTSW	3	96651155	missense	probably damaging	1.00
X0064:Itga10	UTSW	3	96652936	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- GACCTCAGTGAACTGCTGAC -3'
(R):5'- TCCTCAGTCTTTCTAGATACAGAGTC -3'

Sequencing Primer
(F):5'- TACACTATACGGGCATGCCTGC -3'
(R):5'- CCAAGACTTGTGGGTCAGCTAATC -3'

Posted On

2017-02-03