Incidental Mutation 'IGL02988:Lmbr1'
ID453478
Institutional Source Beutler Lab
Gene Symbol Lmbr1
Ensembl Gene ENSMUSG00000010721
Gene Namelimb region 1
Synonyms1110048D14Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #IGL02988 (G1)
Quality Score201
Status Validated
Chromosome5
Chromosomal Location29229802-29378390 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to T at 29292223 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143316 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055195] [ENSMUST00000179191] [ENSMUST00000179191] [ENSMUST00000196321] [ENSMUST00000198105] [ENSMUST00000200564]
Predicted Effect probably null
Transcript: ENSMUST00000055195
SMART Domains Protein: ENSMUSP00000058405
Gene: ENSMUSG00000010721

DomainStartEndE-ValueType
Pfam:LMBR1 26 281 3.5e-46 PFAM
Pfam:LMBR1 239 445 1.7e-38 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000179191
SMART Domains Protein: ENSMUSP00000136160
Gene: ENSMUSG00000010721

DomainStartEndE-ValueType
Pfam:LMBR1 23 108 6e-31 PFAM
Pfam:LMBR1 106 418 5.3e-99 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000179191
SMART Domains Protein: ENSMUSP00000136160
Gene: ENSMUSG00000010721

DomainStartEndE-ValueType
Pfam:LMBR1 23 108 6e-31 PFAM
Pfam:LMBR1 106 418 5.3e-99 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000196321
SMART Domains Protein: ENSMUSP00000143348
Gene: ENSMUSG00000010721

DomainStartEndE-ValueType
Pfam:LMBR1 1 323 4e-106 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000198105
SMART Domains Protein: ENSMUSP00000142755
Gene: ENSMUSG00000010721

DomainStartEndE-ValueType
Pfam:LMBR1 23 107 5.4e-30 PFAM
Pfam:LMBR1 106 419 3.4e-101 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198367
Predicted Effect probably benign
Transcript: ENSMUST00000200149
Predicted Effect probably null
Transcript: ENSMUST00000200564
SMART Domains Protein: ENSMUSP00000143316
Gene: ENSMUSG00000010721

DomainStartEndE-ValueType
Pfam:LMBR1 1 310 8.6e-92 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 0.0%
  • 3x: 0.0%
  • 10x: 0.0%
  • 20x: 0.0%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: This gene encodes a member of the LMBR1-like membrane protein family. Another member of this protein family has been shown to be a lipocalin transmembrane receptor. A highly conserved, cis-acting regulatory module for the sonic hedgehog gene is located within an intron of this gene. Consequently, disruption of this genic region can alter sonic hedgehog expression and affect limb patterning, but it is not known if this gene functions directly in limb development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele show minor coalitions of distal wrist bones and a low incidence of limb defects, including oligodactyly, brachyphalangia, and soft tissue or bony syndactyly. Homozygotes for another null allele exhibit normal morphology,clinical chemistry, hematology and behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110079O15Rik A G 1: 87,475,204 probably null Het
4933416I08Rik TCC TCCC X: 53,690,895 noncoding transcript Het
Adgrd1 G A 5: 129,144,010 A488T probably benign Het
AF529169 A G 9: 89,602,739 S202P probably benign Het
Ano3 T C 2: 110,775,010 S284G probably damaging Het
Aox2 G T 1: 58,337,350 V897L probably benign Het
Arl6 T A 16: 59,613,846 probably null Het
Blnk G A 19: 40,929,216 T441M probably damaging Het
Casp8ap2 C T 4: 32,644,590 T1221I probably benign Het
Cbll1 A T 12: 31,492,172 F63L possibly damaging Het
Cdk14 A G 5: 5,036,484 Y279H probably damaging Het
Cflar A T 1: 58,741,031 I265F possibly damaging Het
Cilp TGGG TGG 9: 65,280,130 probably null Het
Crb1 CG C 1: 139,237,086 probably null Het
Cyp3a13 A T 5: 137,899,010 Y347* probably null Het
Defa27 T C 8: 21,315,567 S8P probably damaging Het
Depdc5 A C 5: 32,956,167 probably null Het
Dlg5 A G 14: 24,166,255 F573S probably damaging Het
Fam20c A T 5: 138,755,994 E120V probably benign Het
Fam53a T C 5: 33,607,475 K296E probably damaging Het
Fcna G C 2: 25,630,681 probably benign Het
Fndc1 T C 17: 7,753,523 T1526A possibly damaging Het
Gm14325 A C 2: 177,834,249 probably null Het
Gm438 T A 4: 144,786,530 probably benign Het
Gm7582 G A 1: 85,041,867 noncoding transcript Het
Golga7b A C 19: 42,266,800 Y63S probably damaging Het
Hexb A G 13: 97,198,221 L14P unknown Het
Hsd17b3 A C 13: 64,089,100 L10R probably damaging Het
Il6st T C 13: 112,498,886 F611L probably damaging Het
Ints13 T A 6: 146,556,148 T411S possibly damaging Het
Kif18b C A 11: 102,908,320 C685F probably damaging Het
Kif5c A G 2: 49,619,717 N19S probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Mrc2 G A 11: 105,325,571 R62Q probably benign Het
Myo1g T C 11: 6,508,183 probably benign Het
Myo5a A T 9: 75,130,141 probably benign Het
Nobox G A 6: 43,305,161 S326L possibly damaging Het
Nsl1 C A 1: 191,063,103 S22* probably null Het
Olfr1052 T C 2: 86,298,479 I221T probably damaging Het
Olfr1469 A C 19: 13,411,462 K298Q possibly damaging Het
Pdia3 T A 2: 121,429,556 L192Q probably damaging Het
Pkd2 A T 5: 104,503,605 R940* probably null Het
Plcd3 T A 11: 103,076,742 Q458L probably benign Het
Polm T A 11: 5,836,343 T75S probably benign Het
Pon3 T A 6: 5,232,330 D230V possibly damaging Het
Pxdn A T 12: 30,003,114 K917* probably null Het
Rad54l2 A G 9: 106,700,585 S1046P probably benign Het
Rb1cc1 T C 1: 6,247,811 probably null Het
Rnf215 A G 11: 4,136,785 E194G probably damaging Het
Rorb A T 19: 18,937,972 F441I probably damaging Het
Sel1l2 C A 2: 140,248,588 G378V probably damaging Het
Sema6a G T 18: 47,298,214 A139D probably damaging Het
Serpinb3d A T 1: 107,078,536 M274K probably benign Het
Siglec15 A C 18: 78,049,247 L32R probably damaging Het
Siglecg A T 7: 43,418,052 D681V probably damaging Het
Slc6a13 G T 6: 121,326,107 probably benign Het
Slc9b2 G T 3: 135,318,418 A77S probably benign Het
Slit3 T A 11: 35,708,063 V1498D probably damaging Het
Speer4c A C 5: 15,714,216 probably benign Het
Stxbp2 T C 8: 3,633,267 probably benign Het
Tbc1d9b T C 11: 50,151,946 S482P possibly damaging Het
Tec A G 5: 72,768,747 S321P possibly damaging Het
Tenm3 A G 8: 48,235,346 M2402T probably damaging Het
Thrap3 G A 4: 126,165,542 probably null Het
Tm4sf1 A T 3: 57,293,116 probably null Het
Tmcc1 T C 6: 116,042,928 E306G probably damaging Het
Traf3ip3 A T 1: 193,194,874 probably null Het
Utf1 C T 7: 139,943,962 P30L possibly damaging Het
Wdfy3 A T 5: 101,929,981 C880S probably damaging Het
Other mutations in Lmbr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01645:Lmbr1 APN 5 29235055 missense probably damaging 1.00
IGL02285:Lmbr1 APN 5 29254235 splice site probably benign
IGL02793:Lmbr1 APN 5 29292188 missense probably damaging 1.00
IGL02875:Lmbr1 APN 5 29292188 missense probably damaging 1.00
IGL03103:Lmbr1 APN 5 29235016 missense probably damaging 0.99
R0255:Lmbr1 UTSW 5 29252755 missense probably damaging 1.00
R0594:Lmbr1 UTSW 5 29292209 missense possibly damaging 0.87
R0993:Lmbr1 UTSW 5 29287393 missense probably damaging 1.00
R1036:Lmbr1 UTSW 5 29258747 missense probably damaging 1.00
R1570:Lmbr1 UTSW 5 29254558 missense probably damaging 1.00
R1724:Lmbr1 UTSW 5 29361083 missense probably benign 0.03
R2056:Lmbr1 UTSW 5 29233094 missense probably benign 0.07
R2996:Lmbr1 UTSW 5 29363933 missense probably benign 0.29
R4082:Lmbr1 UTSW 5 29258755 missense probably damaging 1.00
R4618:Lmbr1 UTSW 5 29346865 missense probably damaging 1.00
R4842:Lmbr1 UTSW 5 29287426 missense probably damaging 0.97
R4857:Lmbr1 UTSW 5 29323809 missense probably damaging 0.98
R5495:Lmbr1 UTSW 5 29346853 nonsense probably null
R5647:Lmbr1 UTSW 5 29263393 critical splice donor site probably null
R6393:Lmbr1 UTSW 5 29254294 missense probably damaging 1.00
R6466:Lmbr1 UTSW 5 29378168 missense probably benign 0.05
R6486:Lmbr1 UTSW 5 29323861 missense probably damaging 0.99
R6576:Lmbr1 UTSW 5 29291310 missense probably damaging 1.00
R6874:Lmbr1 UTSW 5 29292906 missense probably damaging 1.00
R7085:Lmbr1 UTSW 5 29361092 splice site probably null
R7484:Lmbr1 UTSW 5 29346852 start gained probably benign
R7487:Lmbr1 UTSW 5 29254264 missense probably benign 0.38
R8390:Lmbr1 UTSW 5 29235042 missense probably benign 0.00
Z1088:Lmbr1 UTSW 5 29323816 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAGTGCAAAAGGCTTAGTG -3'
(R):5'- GGAGCATTTTCTCCCTTTGAAAC -3'

Sequencing Primer
(F):5'- GCAAAAGGCTTAGTGAACAAACTATC -3'
(R):5'- CTCCCTTTGAAACATTTCTCAAAAGG -3'
Posted On2017-02-08