Incidental Mutation 'R5845:Lrmp'
ID453566
Institutional Source Beutler Lab
Gene Symbol Lrmp
Ensembl Gene ENSMUSG00000030263
Gene Namelymphoid-restricted membrane protein
SynonymsD6Int8, D6Int7, D6Int5, D6Int4, D6Int3, Jaw1
MMRRC Submission 044063-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5845 (G1)
Quality Score184
Status Validated
Chromosome6
Chromosomal Location145115653-145174934 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 145171666 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 376 (M376I)
Ref Sequence ENSEMBL: ENSMUSP00000032396 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032396] [ENSMUST00000060797] [ENSMUST00000111728] [ENSMUST00000135984] [ENSMUST00000204105]
Predicted Effect probably benign
Transcript: ENSMUST00000032396
AA Change: M376I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000032396
Gene: ENSMUSG00000030263
AA Change: M376I

DomainStartEndE-ValueType
Pfam:MRVI1 10 539 3.2e-265 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000060797
SMART Domains Protein: ENSMUSP00000062279
Gene: ENSMUSG00000043541

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
Pfam:Casc1_N 29 229 5.5e-61 PFAM
Pfam:Casc1 241 469 3.4e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000111727
Predicted Effect probably benign
Transcript: ENSMUST00000111728
SMART Domains Protein: ENSMUSP00000107357
Gene: ENSMUSG00000043541

DomainStartEndE-ValueType
coiled coil region 1 45 N/A INTRINSIC
Pfam:Casc1 228 456 6.1e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132937
Predicted Effect unknown
Transcript: ENSMUST00000132948
AA Change: M340I
SMART Domains Protein: ENSMUSP00000120248
Gene: ENSMUSG00000030263
AA Change: M340I

DomainStartEndE-ValueType
Pfam:MRVI1 8 504 3.7e-248 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135191
Predicted Effect probably benign
Transcript: ENSMUST00000135984
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149244
Predicted Effect probably benign
Transcript: ENSMUST00000204105
SMART Domains Protein: ENSMUSP00000144783
Gene: ENSMUSG00000043541

DomainStartEndE-ValueType
low complexity region 1 14 N/A INTRINSIC
Pfam:Casc1_N 29 229 3.4e-57 PFAM
Pfam:Casc1 241 469 2.3e-11 PFAM
Meta Mutation Damage Score 0.0592 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.3%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encode dby this gene is expressed in a developmentally regulated manner in lymphoid cell lines and tissues. The protein is localized to the cytoplasmic face of the endoplasmic reticulum. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 A T 5: 121,626,083 Y928N probably benign Het
Als2cr12 T A 1: 58,667,778 E243D possibly damaging Het
Amz2 T C 11: 109,433,929 F213S probably damaging Het
Cage1 T A 13: 38,015,706 S732C probably damaging Het
Ccnf C A 17: 24,240,793 D229Y possibly damaging Het
Cdon G T 9: 35,457,466 C332F probably damaging Het
Clca3b G A 3: 144,825,316 R758C possibly damaging Het
Cyp2ab1 C T 16: 20,312,332 R349H probably benign Het
Dock10 C T 1: 80,505,742 probably benign Het
Dock5 A T 14: 67,841,101 Y225N possibly damaging Het
Ear2 G A 14: 44,103,161 R92K probably benign Het
Eif3c T C 7: 126,564,755 S39G probably damaging Het
Eml3 A G 19: 8,939,218 D701G probably damaging Het
Fat3 G A 9: 16,377,210 T339I probably damaging Het
Fbn2 T C 18: 58,053,768 D1687G possibly damaging Het
Fcnb C T 2: 28,079,621 probably null Het
Fscb A G 12: 64,472,784 V636A unknown Het
Gm6124 A G 7: 39,219,875 noncoding transcript Het
Hectd4 T A 5: 121,307,524 probably null Het
Hrnr A T 3: 93,332,637 H3394L unknown Het
Hs1bp3 A G 12: 8,336,275 R226G probably benign Het
Ifngr2 T C 16: 91,555,059 V61A probably benign Het
Kcnk2 T C 1: 189,277,721 probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Mgam T A 6: 40,675,323 N810K possibly damaging Het
Mis18a A G 16: 90,721,634 probably null Het
Nsmce3 A G 7: 64,872,188 V244A possibly damaging Het
Olfr1129 T C 2: 87,576,023 I313T probably benign Het
Plxna4 A T 6: 32,237,776 V590D probably damaging Het
Prkab1 A T 5: 116,024,160 D30E probably benign Het
Rasgrp3 A T 17: 75,503,147 N281Y possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sept2 T A 1: 93,499,035 probably null Het
Slc26a6 T G 9: 108,862,083 V609G possibly damaging Het
Spta1 T A 1: 174,241,096 M2154K probably damaging Het
Stoml2 T G 4: 43,030,008 probably benign Het
Sult6b1 A C 17: 78,894,630 S148A probably damaging Het
Tmem131l A G 3: 83,940,553 V335A probably damaging Het
Tmem221 T A 8: 71,555,144 probably null Het
Tmem88 C G 11: 69,397,678 Q138H probably benign Het
Trpm8 T C 1: 88,328,180 Y186H probably benign Het
Trpv1 T C 11: 73,240,581 I7T probably damaging Het
Ttc34 T C 4: 154,865,472 S961P probably benign Het
Ubr1 T C 2: 120,904,005 D1138G probably benign Het
Ubr7 C T 12: 102,766,312 R188C probably damaging Het
Uspl1 C T 5: 149,193,960 P118S probably benign Het
Vdr C A 15: 97,869,766 E114D possibly damaging Het
Zfp853 C T 5: 143,288,669 V399M unknown Het
Zswim4 T A 8: 84,217,242 probably null Het
Other mutations in Lrmp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00918:Lrmp APN 6 145167994 missense probably damaging 1.00
IGL01066:Lrmp APN 6 145160955 missense probably damaging 1.00
IGL01877:Lrmp APN 6 145147799 missense probably damaging 0.99
IGL02154:Lrmp APN 6 145138241 missense possibly damaging 0.92
IGL02727:Lrmp APN 6 145174618 missense possibly damaging 0.78
FR4976:Lrmp UTSW 6 145173785 unclassified probably benign
R0238:Lrmp UTSW 6 145171978 unclassified probably benign
R0239:Lrmp UTSW 6 145171978 unclassified probably benign
R0454:Lrmp UTSW 6 145167984 missense possibly damaging 0.73
R0485:Lrmp UTSW 6 145165212 missense probably damaging 1.00
R0487:Lrmp UTSW 6 145165260 missense probably benign 0.02
R0554:Lrmp UTSW 6 145165287 missense probably benign 0.01
R0634:Lrmp UTSW 6 145174628 missense probably damaging 0.98
R1440:Lrmp UTSW 6 145174511 missense possibly damaging 0.77
R1574:Lrmp UTSW 6 145158630 splice site probably benign
R1697:Lrmp UTSW 6 145137615 splice site probably benign
R1968:Lrmp UTSW 6 145169773 missense probably damaging 0.98
R3735:Lrmp UTSW 6 145160870 splice site probably benign
R3736:Lrmp UTSW 6 145160870 splice site probably benign
R4643:Lrmp UTSW 6 145168060 missense probably benign 0.17
R4812:Lrmp UTSW 6 145148011 missense probably damaging 1.00
R4916:Lrmp UTSW 6 145165301 missense probably damaging 1.00
R5183:Lrmp UTSW 6 145138220 missense probably benign 0.23
R6701:Lrmp UTSW 6 145144976 nonsense probably null
R6735:Lrmp UTSW 6 145160893 missense probably damaging 1.00
R7083:Lrmp UTSW 6 145169783 missense probably damaging 1.00
R7317:Lrmp UTSW 6 145158698 missense possibly damaging 0.93
R7468:Lrmp UTSW 6 145173701 splice site probably null
RF003:Lrmp UTSW 6 145173783 unclassified probably benign
RF015:Lrmp UTSW 6 145173783 unclassified probably benign
RF017:Lrmp UTSW 6 145173784 unclassified probably benign
RF027:Lrmp UTSW 6 145173790 unclassified probably benign
RF029:Lrmp UTSW 6 145173790 unclassified probably benign
RF030:Lrmp UTSW 6 145173788 unclassified probably benign
RF030:Lrmp UTSW 6 145173790 unclassified probably benign
RF038:Lrmp UTSW 6 145173790 unclassified probably benign
RF043:Lrmp UTSW 6 145173790 unclassified probably benign
RF044:Lrmp UTSW 6 145173790 unclassified probably benign
RF048:Lrmp UTSW 6 145173784 unclassified probably benign
RF052:Lrmp UTSW 6 145160531 critical splice acceptor site probably benign
RF054:Lrmp UTSW 6 145173788 unclassified probably benign
RF055:Lrmp UTSW 6 145173785 unclassified probably benign
Z1177:Lrmp UTSW 6 145148074 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGGTAGCCATCTTCTCTTCG -3'
(R):5'- TGCCTAAGTCAGTGCAGAAAC -3'

Sequencing Primer
(F):5'- TTCGAAGAGTGACCATTGCC -3'
(R):5'- GTGCAGAAACCACACTGTCTTG -3'
Posted On2017-02-10