Incidental Mutation 'R5845:Clca3b'
ID453557
Institutional Source Beutler Lab
Gene Symbol Clca3b
Ensembl Gene ENSMUSG00000037033
Gene Namechloride channel accessory 3B
SynonymsClca4
MMRRC Submission 044063-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R5845 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location144822623-144849357 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 144825316 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 758 (R758C)
Ref Sequence ENSEMBL: ENSMUSP00000124581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159989]
Predicted Effect possibly damaging
Transcript: ENSMUST00000159989
AA Change: R758C

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124581
Gene: ENSMUSG00000037033
AA Change: R758C

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
VWA 306 481 6.22e-19 SMART
FN3 762 861 4.93e0 SMART
low complexity region 880 1025 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.3%
Validation Efficiency 97% (59/61)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 A T 5: 121,626,083 Y928N probably benign Het
Als2cr12 T A 1: 58,667,778 E243D possibly damaging Het
Amz2 T C 11: 109,433,929 F213S probably damaging Het
Cage1 T A 13: 38,015,706 S732C probably damaging Het
Ccnf C A 17: 24,240,793 D229Y possibly damaging Het
Cdon G T 9: 35,457,466 C332F probably damaging Het
Cyp2ab1 C T 16: 20,312,332 R349H probably benign Het
Dock10 C T 1: 80,505,742 probably benign Het
Dock5 A T 14: 67,841,101 Y225N possibly damaging Het
Ear2 G A 14: 44,103,161 R92K probably benign Het
Eif3c T C 7: 126,564,755 S39G probably damaging Het
Eml3 A G 19: 8,939,218 D701G probably damaging Het
Fat3 G A 9: 16,377,210 T339I probably damaging Het
Fbn2 T C 18: 58,053,768 D1687G possibly damaging Het
Fcnb C T 2: 28,079,621 probably null Het
Fscb A G 12: 64,472,784 V636A unknown Het
Gm6124 A G 7: 39,219,875 noncoding transcript Het
Hectd4 T A 5: 121,307,524 probably null Het
Hrnr A T 3: 93,332,637 H3394L unknown Het
Hs1bp3 A G 12: 8,336,275 R226G probably benign Het
Ifngr2 T C 16: 91,555,059 V61A probably benign Het
Kcnk2 T C 1: 189,277,721 probably benign Het
Kmt2d G A 15: 98,852,109 probably benign Het
Lrmp G A 6: 145,171,666 M376I probably benign Het
Mgam T A 6: 40,675,323 N810K possibly damaging Het
Mis18a A G 16: 90,721,634 probably null Het
Nsmce3 A G 7: 64,872,188 V244A possibly damaging Het
Olfr1129 T C 2: 87,576,023 I313T probably benign Het
Plxna4 A T 6: 32,237,776 V590D probably damaging Het
Prkab1 A T 5: 116,024,160 D30E probably benign Het
Rasgrp3 A T 17: 75,503,147 N281Y possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Sept2 T A 1: 93,499,035 probably null Het
Slc26a6 T G 9: 108,862,083 V609G possibly damaging Het
Spta1 T A 1: 174,241,096 M2154K probably damaging Het
Stoml2 T G 4: 43,030,008 probably benign Het
Sult6b1 A C 17: 78,894,630 S148A probably damaging Het
Tmem131l A G 3: 83,940,553 V335A probably damaging Het
Tmem221 T A 8: 71,555,144 probably null Het
Tmem88 C G 11: 69,397,678 Q138H probably benign Het
Trpm8 T C 1: 88,328,180 Y186H probably benign Het
Trpv1 T C 11: 73,240,581 I7T probably damaging Het
Ttc34 T C 4: 154,865,472 S961P probably benign Het
Ubr1 T C 2: 120,904,005 D1138G probably benign Het
Ubr7 C T 12: 102,766,312 R188C probably damaging Het
Uspl1 C T 5: 149,193,960 P118S probably benign Het
Vdr C A 15: 97,869,766 E114D possibly damaging Het
Zfp853 C T 5: 143,288,669 V399M unknown Het
Zswim4 T A 8: 84,217,242 probably null Het
Other mutations in Clca3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Clca3b APN 3 144836632 missense probably damaging 0.96
IGL00425:Clca3b APN 3 144836581 missense probably benign 0.14
IGL00725:Clca3b APN 3 144839162 missense probably benign 0.01
IGL00898:Clca3b APN 3 144844628 splice site probably benign
IGL00953:Clca3b APN 3 144847211 nonsense probably null
IGL01089:Clca3b APN 3 144823522 missense probably benign
IGL01376:Clca3b APN 3 144826051 missense possibly damaging 0.60
IGL01996:Clca3b APN 3 144849163 missense probably benign 0.04
IGL02022:Clca3b APN 3 144841410 critical splice donor site probably null
IGL02200:Clca3b APN 3 144841429 missense probably damaging 1.00
IGL02314:Clca3b APN 3 144828142 splice site probably benign
IGL02331:Clca3b APN 3 144841406 splice site probably benign
IGL02429:Clca3b APN 3 144828135 missense probably damaging 1.00
IGL02868:Clca3b APN 3 144827564 missense probably damaging 1.00
IGL03095:Clca3b APN 3 144846910 nonsense probably null
IGL03331:Clca3b APN 3 144827963 missense probably benign
R0242:Clca3b UTSW 3 144841465 missense probably benign 0.00
R0242:Clca3b UTSW 3 144841465 missense probably benign 0.00
R0506:Clca3b UTSW 3 144822866 unclassified probably benign
R0524:Clca3b UTSW 3 144825321 missense probably benign
R0637:Clca3b UTSW 3 144827940 missense probably benign 0.03
R1577:Clca3b UTSW 3 144823519 missense probably damaging 1.00
R1641:Clca3b UTSW 3 144823513 missense possibly damaging 0.53
R1680:Clca3b UTSW 3 144837824 missense probably damaging 1.00
R2240:Clca3b UTSW 3 144825935 missense probably benign 0.22
R2248:Clca3b UTSW 3 144825219 missense probably benign 0.01
R2259:Clca3b UTSW 3 144846381 missense possibly damaging 0.80
R2920:Clca3b UTSW 3 144837853 missense probably benign 0.31
R2920:Clca3b UTSW 3 144846931 missense probably benign 0.01
R4355:Clca3b UTSW 3 144825458 splice site probably null
R4691:Clca3b UTSW 3 144839092 missense probably benign 0.02
R4828:Clca3b UTSW 3 144844512 missense probably benign 0.02
R4845:Clca3b UTSW 3 144825270 missense probably benign
R5182:Clca3b UTSW 3 144828015 missense probably damaging 0.99
R5396:Clca3b UTSW 3 144847171 missense probably damaging 0.99
R5429:Clca3b UTSW 3 144846459 missense probably damaging 1.00
R5572:Clca3b UTSW 3 144827309 missense probably damaging 1.00
R5657:Clca3b UTSW 3 144827383 missense probably benign 0.25
R6505:Clca3b UTSW 3 144825259 missense probably benign 0.18
R6677:Clca3b UTSW 3 144823384 missense probably benign 0.13
R6707:Clca3b UTSW 3 144844527 missense probably benign 0.00
R7001:Clca3b UTSW 3 144827972 missense possibly damaging 0.48
R7285:Clca3b UTSW 3 144837758 missense probably benign 0.00
R7323:Clca3b UTSW 3 144825920 missense possibly damaging 0.60
R7324:Clca3b UTSW 3 144841420 missense possibly damaging 0.81
R7334:Clca3b UTSW 3 144836656 nonsense probably null
R7403:Clca3b UTSW 3 144823498 missense probably benign 0.00
R7798:Clca3b UTSW 3 144828130 missense probably damaging 1.00
R8008:Clca3b UTSW 3 144844609 missense probably benign 0.44
R8132:Clca3b UTSW 3 144847174 missense probably benign 0.13
R8181:Clca3b UTSW 3 144839137 missense probably benign 0.00
R8305:Clca3b UTSW 3 144825937 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCAGCTTGTATCTTTTGAAG -3'
(R):5'- TTCAATATCTGCACTGAGTACCG -3'

Sequencing Primer
(F):5'- CCAGCTTGTATCTTTTGAAGTTTCAG -3'
(R):5'- TATCTGCACTGAGTACCGGCAAG -3'
Posted On2017-02-10