Incidental Mutation 'R5951:Dhx32'
ID470886
Institutional Source Beutler Lab
Gene Symbol Dhx32
Ensembl Gene ENSMUSG00000030986
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 32
SynonymsDdx32
MMRRC Submission 044141-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R5951 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location133720942-133782726 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 133737328 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 326 (L326Q)
Ref Sequence ENSEMBL: ENSMUSP00000066067 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033290] [ENSMUST00000063669] [ENSMUST00000106139]
Predicted Effect probably damaging
Transcript: ENSMUST00000033290
AA Change: L326Q

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000033290
Gene: ENSMUSG00000030986
AA Change: L326Q

DomainStartEndE-ValueType
Blast:DEXDc 67 253 1e-107 BLAST
SCOP:d1jpna2 77 289 9e-21 SMART
HA2 465 556 3.35e-21 SMART
Pfam:OB_NTP_bind 597 704 1.7e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000063669
AA Change: L326Q

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000066067
Gene: ENSMUSG00000030986
AA Change: L326Q

DomainStartEndE-ValueType
Blast:DEXDc 67 253 1e-107 BLAST
SCOP:d1jpna2 77 289 9e-21 SMART
HA2 465 556 3.35e-21 SMART
Pfam:OB_NTP_bind 594 704 4.6e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106139
AA Change: L186Q

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000101745
Gene: ENSMUSG00000030986
AA Change: L186Q

DomainStartEndE-ValueType
Blast:DEXDc 1 113 5e-54 BLAST
SCOP:d1jpna2 1 149 6e-11 SMART
HA2 325 416 3.35e-21 SMART
Pfam:OB_NTP_bind 457 564 1.2e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120338
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140593
Meta Mutation Damage Score 0.036 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.4%
Validation Efficiency 100% (78/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this DEAD box protein family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a member of this family. The function of this member has not been determined. Alternative splicing of this gene generates 2 transcript variants, but the full length nature of one of the variants has not been defined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568D16Rik T A 2: 35,354,799 E180D probably damaging Het
Add3 A G 19: 53,244,289 probably null Het
Adgrv1 A T 13: 81,442,501 I4396N probably damaging Het
Apc C T 18: 34,317,146 S2331L possibly damaging Het
Apoh G T 11: 108,395,903 C51F probably damaging Het
Arid4b T C 13: 14,143,063 V177A possibly damaging Het
Atp13a1 T A 8: 69,797,285 I343N probably damaging Het
Bcar1 T C 8: 111,713,400 D654G probably benign Het
Brox T C 1: 183,282,508 K245R probably damaging Het
Ccdc146 A T 5: 21,319,579 S258R possibly damaging Het
Ccdc169 A C 3: 55,140,141 K18Q probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Crot C A 5: 8,969,120 E478* probably null Het
Dgkq A T 5: 108,654,370 M443K probably damaging Het
Dtwd1 A G 2: 126,158,422 I93V probably benign Het
Ehmt2 C T 17: 34,899,381 T44I probably benign Het
Enc1 T C 13: 97,245,257 S92P probably benign Het
Epha5 T C 5: 84,331,192 probably benign Het
Eya4 T A 10: 23,155,994 S244C probably damaging Het
Fmnl3 G A 15: 99,325,910 R302W probably damaging Het
Fscn3 A T 6: 28,436,174 I490F possibly damaging Het
Galntl6 A G 8: 57,962,402 V239A probably benign Het
Glg1 T C 8: 111,165,691 I841V possibly damaging Het
Gm15455 T C 1: 33,837,812 noncoding transcript Het
Gpd1l C T 9: 114,914,405 M142I probably benign Het
Helb A G 10: 120,091,748 V819A possibly damaging Het
Hnrnpul2 T G 19: 8,824,891 F374C probably damaging Het
Hoxc10 G A 15: 102,967,318 S154N possibly damaging Het
Ice2 A T 9: 69,412,369 T367S possibly damaging Het
Iqca A T 1: 90,140,097 probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Klhl14 T A 18: 21,651,620 H250L probably damaging Het
Kmt2c A T 5: 25,330,803 D1447E probably benign Het
Larp1 G T 11: 58,049,939 M630I probably benign Het
Lrp2 A G 2: 69,496,323 probably null Het
Map4k3 G T 17: 80,603,998 Q673K probably benign Het
Mettl16 A G 11: 74,795,997 N201D possibly damaging Het
Mrpl15 C A 1: 4,785,733 probably benign Het
Mthfd1l T A 10: 4,048,222 V655D probably damaging Het
Odf1 T C 15: 38,226,287 Y144H probably damaging Het
Olfr1093 G T 2: 86,786,227 V166L probably benign Het
Olfr38 G T 6: 42,762,559 C169F probably damaging Het
Padi1 T C 4: 140,814,829 Y594C probably damaging Het
Palm3 T A 8: 84,029,420 D520E probably benign Het
Paox G A 7: 140,127,654 C130Y probably damaging Het
Parpbp T A 10: 88,139,907 S115C probably damaging Het
Pcnx3 A G 19: 5,671,680 V1438A possibly damaging Het
Pdlim2 T A 14: 70,167,780 D212V probably benign Het
Pi4ka A G 16: 17,303,142 F53L probably damaging Het
Pik3c2a A T 7: 116,368,184 D839E probably damaging Het
Pou2f1 T C 1: 165,883,056 probably benign Het
Ppl A T 16: 5,088,628 Y1268N probably benign Het
Prelid3a C T 18: 67,464,941 S6L probably benign Het
Ptk2 T G 15: 73,303,833 D285A possibly damaging Het
Rasd2 T G 8: 75,222,183 Y246D probably damaging Het
Rhbdl2 A G 4: 123,814,327 T110A probably benign Het
Rhobtb1 T A 10: 69,270,255 F217I probably damaging Het
Serhl T C 15: 83,103,036 probably benign Het
Sh3tc2 A G 18: 61,990,007 E613G probably damaging Het
Slc26a3 A G 12: 31,452,715 probably benign Het
Steap4 T C 5: 7,975,769 I110T probably benign Het
Syde1 C A 10: 78,589,316 R287L possibly damaging Het
Tmem184c C T 8: 77,598,662 probably null Het
Trmt44 C A 5: 35,572,688 probably benign Het
Ttbk2 G T 2: 120,773,283 S256R probably benign Het
Ttll6 A T 11: 96,145,510 I322F probably damaging Het
Ubap2 A T 4: 41,205,753 probably null Het
Wsb2 A T 5: 117,377,535 T402S probably damaging Het
Other mutations in Dhx32
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01444:Dhx32 APN 7 133748977 missense possibly damaging 0.76
IGL03398:Dhx32 APN 7 133759525 missense probably damaging 1.00
R0729:Dhx32 UTSW 7 133737421 missense probably benign 0.01
R1054:Dhx32 UTSW 7 133725272 missense probably damaging 1.00
R1438:Dhx32 UTSW 7 133737340 missense possibly damaging 0.87
R1532:Dhx32 UTSW 7 133749024 missense possibly damaging 0.93
R1864:Dhx32 UTSW 7 133737296 missense probably benign 0.00
R1865:Dhx32 UTSW 7 133737296 missense probably benign 0.00
R2074:Dhx32 UTSW 7 133721292 missense probably benign 0.04
R2075:Dhx32 UTSW 7 133721292 missense probably benign 0.04
R2119:Dhx32 UTSW 7 133722247 nonsense probably null
R2377:Dhx32 UTSW 7 133724478 missense probably damaging 1.00
R3125:Dhx32 UTSW 7 133725356 missense probably damaging 1.00
R4519:Dhx32 UTSW 7 133734109 missense probably damaging 1.00
R4970:Dhx32 UTSW 7 133738655 intron probably benign
R5538:Dhx32 UTSW 7 133723217 missense probably benign
R5616:Dhx32 UTSW 7 133721228 makesense probably null
R6081:Dhx32 UTSW 7 133722212 missense probably damaging 1.00
R6297:Dhx32 UTSW 7 133742800 missense probably damaging 1.00
R6319:Dhx32 UTSW 7 133737226 missense probably damaging 1.00
R7088:Dhx32 UTSW 7 133742688 missense probably damaging 1.00
R7257:Dhx32 UTSW 7 133759477 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- AATAAAGAGAACCCTGGGTCAC -3'
(R):5'- ACAACTTTATGGAATTGTGGGGTC -3'

Sequencing Primer
(F):5'- AGAACCCTGGGTCACAGTGC -3'
(R):5'- GAACTTGTGTGTCAGGAAG -3'
Posted On2017-03-31