Incidental Mutation 'R5980:Olfr1058'
ID481361
Institutional Source Beutler Lab
Gene Symbol Olfr1058
Ensembl Gene ENSMUSG00000075186
Gene Nameolfactory receptor 1058
SynonymsGA_x6K02T2Q125-47855818-47854868, MOR190-2
MMRRC Submission 044162-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R5980 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location86384760-86388561 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 86385797 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 207 (L207*)
Ref Sequence ENSEMBL: ENSMUSP00000151037 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102631] [ENSMUST00000213998]
Predicted Effect probably null
Transcript: ENSMUST00000102631
AA Change: L207*
SMART Domains Protein: ENSMUSP00000099691
Gene: ENSMUSG00000075186
AA Change: L207*

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1e-49 PFAM
Pfam:7tm_1 41 290 1.1e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000213998
AA Change: L207*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215214
Meta Mutation Damage Score 0.9718 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 96% (50/52)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,567,055 N508D possibly damaging Het
Ago1 C T 4: 126,460,569 probably benign Het
Apol6 A T 15: 77,051,019 T163S possibly damaging Het
Arhgap27 T C 11: 103,356,269 T33A probably benign Het
Atg7 C A 6: 114,680,236 F132L possibly damaging Het
Cep104 C A 4: 153,988,473 A396E probably benign Het
Cers4 T A 8: 4,518,269 C107* probably null Het
Cntn6 T C 6: 104,848,132 S878P probably damaging Het
Dnah6 T C 6: 73,181,722 K633E probably benign Het
Dst T A 1: 34,182,891 I2592K probably benign Het
Ep400 G A 5: 110,733,729 probably benign Het
Fbn1 A G 2: 125,315,404 C2320R probably damaging Het
Gm17677 A C 9: 35,741,615 D51A probably damaging Het
Gpi1 A G 7: 34,228,926 probably null Het
Gse1 T G 8: 120,229,637 probably benign Het
Hid1 G A 11: 115,350,948 T612I possibly damaging Het
Ighmbp2 G T 19: 3,265,295 H708Q probably benign Het
Igkv10-95 T C 6: 68,680,589 S10P probably damaging Het
Igkv14-100 T C 6: 68,519,025 V5A probably benign Het
Irgq G A 7: 24,533,345 G204S probably damaging Het
Kansl1 T C 11: 104,343,637 K681R possibly damaging Het
Kcnv1 C A 15: 45,109,414 V358L probably damaging Het
Lrp2 A T 2: 69,535,005 S275T probably damaging Het
Lysmd1 A T 3: 95,137,908 D155V probably damaging Het
Magel2 A T 7: 62,380,596 I1083F unknown Het
Mta3 T A 17: 83,708,405 V12D probably damaging Het
Mtmr4 T C 11: 87,604,151 I423T probably damaging Het
Mup11 A G 4: 60,660,888 Y16H possibly damaging Het
Mycbp G A 4: 123,911,096 V91I probably benign Het
Ngly1 A C 14: 16,270,509 Q72P possibly damaging Het
Nol4 T A 18: 22,952,201 Q52L probably damaging Het
Nrcam T C 12: 44,571,633 V808A probably damaging Het
Olfr9 A G 10: 128,990,440 H176R probably damaging Het
Olfr993 A T 2: 85,414,165 F238Y probably damaging Het
Pik3c2b C A 1: 133,088,308 D869E probably benign Het
Pom121l2 T C 13: 21,983,376 S606P probably damaging Het
Prdm15 G A 16: 97,812,570 R517* probably null Het
Ralgapa1 T A 12: 55,770,616 probably null Het
Saraf T A 8: 34,165,387 F207I probably benign Het
Sema6d A G 2: 124,664,708 D874G probably damaging Het
Sfrp5 A T 19: 42,201,972 L14M unknown Het
Sidt1 A T 16: 44,263,312 C485* probably null Het
Sptbn4 A G 7: 27,372,171 Y1618H probably damaging Het
Syt14 T C 1: 192,980,408 Q127R possibly damaging Het
Tbc1d2 C T 4: 46,629,912 G252R probably benign Het
Ticrr G A 7: 79,660,955 A206T probably damaging Het
Tmem132d T A 5: 127,784,598 I820F probably benign Het
Trafd1 A G 5: 121,373,457 Y433H probably damaging Het
Trim68 A G 7: 102,678,831 V305A probably damaging Het
Vmn2r58 T A 7: 41,865,056 Y163F possibly damaging Het
Vmn2r83 T A 10: 79,478,792 H291Q probably benign Het
Vmn2r95 A G 17: 18,441,362 I457V probably benign Het
Other mutations in Olfr1058
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01353:Olfr1058 APN 2 86386021 nonsense probably null
R0413:Olfr1058 UTSW 2 86385714 missense probably benign 0.02
R1315:Olfr1058 UTSW 2 86386174 missense possibly damaging 0.86
R1609:Olfr1058 UTSW 2 86385494 missense probably benign 0.07
R1951:Olfr1058 UTSW 2 86385511 missense probably benign 0.03
R2184:Olfr1058 UTSW 2 86386145 missense probably benign 0.05
R2351:Olfr1058 UTSW 2 86386127 missense probably damaging 0.99
R4067:Olfr1058 UTSW 2 86386087 nonsense probably null
R4706:Olfr1058 UTSW 2 86386388 missense probably benign 0.29
R5164:Olfr1058 UTSW 2 86385471 missense probably benign
R5224:Olfr1058 UTSW 2 86385849 missense possibly damaging 0.91
R5254:Olfr1058 UTSW 2 86386140 missense possibly damaging 0.65
R5424:Olfr1058 UTSW 2 86385840 nonsense probably null
R5907:Olfr1058 UTSW 2 86385874 missense probably damaging 0.97
R6348:Olfr1058 UTSW 2 86386169 missense probably benign
R6874:Olfr1058 UTSW 2 86385528 missense possibly damaging 0.95
R6897:Olfr1058 UTSW 2 86385680 missense possibly damaging 0.91
R7060:Olfr1058 UTSW 2 86386225 missense possibly damaging 0.95
R7516:Olfr1058 UTSW 2 86385984 missense probably benign 0.35
R7530:Olfr1058 UTSW 2 86386171 missense probably damaging 1.00
R8130:Olfr1058 UTSW 2 86385567 missense probably benign 0.14
Z1088:Olfr1058 UTSW 2 86385756 missense probably benign 0.43
Z1088:Olfr1058 UTSW 2 86386179 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGACTGGATTTGGGCTGC -3'
(R):5'- CTGTAAGCCTCTGTTCTATATGGTC -3'

Sequencing Primer
(F):5'- AATGACTGGATTTGGGCTGCATATAC -3'
(R):5'- GTCAAAAAGACTATGCTTGGTGC -3'
Posted On2017-06-26