Mutagenetix > Incidental Mutation

Incidental Mutation 'R5980:Ralgapa1'

482138

Institutional Source

Beutler Lab

Gene Symbol

Ralgapa1

Ensembl Gene

ENSMUSG00000021027

Gene Name

Ral GTPase activating protein, alpha subunit 1

Synonyms

Garnl1, 4930400K19Rik, 2310003F20Rik, Tulip1

MMRRC Submission

044162-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.823) question?

Stock #

R5980 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

55602896-55821167 bp(-) (GRCm38)

Type of Mutation

splice site (3 bp from exon)

DNA Base Change (assembly)

T to A at 55770616 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000154749 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085385] [ENSMUST00000110687] [ENSMUST00000219432] [ENSMUST00000220367] [ENSMUST00000226244]

AlphaFold

Q6GYP7

Predicted Effect

probably null
Transcript: ENSMUST00000085385

SMART Domains

Protein: ENSMUSP00000082503
Gene: ENSMUSG00000021027

Domain	Start	End	E-Value	Type
low complexity region	644	651	N/A	INTRINSIC
low complexity region	676	690	N/A	INTRINSIC
low complexity region	692	704	N/A	INTRINSIC
low complexity region	894	915	N/A	INTRINSIC
low complexity region	1386	1395	N/A	INTRINSIC
low complexity region	1784	1798	N/A	INTRINSIC
Pfam:Rap_GAP	1824	2003	7.4e-66	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000110687

SMART Domains

Protein: ENSMUSP00000106315
Gene: ENSMUSG00000021027

Domain	Start	End	E-Value	Type
low complexity region	644	651	N/A	INTRINSIC
low complexity region	676	690	N/A	INTRINSIC
low complexity region	692	704	N/A	INTRINSIC
low complexity region	894	915	N/A	INTRINSIC
low complexity region	1386	1395	N/A	INTRINSIC
low complexity region	1784	1798	N/A	INTRINSIC
Pfam:Rap_GAP	1824	2001	1.9e-48	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000219432

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219529

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219542

Predicted Effect

probably null
Transcript: ENSMUST00000220367

Predicted Effect

probably null
Transcript: ENSMUST00000226244

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.2%

Validation Efficiency

96% (50/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a major subunit of the RAL-GTPase activating protein. A similar protein in mouse binds E12, a transcriptional regulator of immunoglobulin genes. The mouse protein also functions in skeletal muscle by binding to the regulatory 14-3-3 proteins upon stimulation with insulin or muscle contraction. A pseudogene of this gene has been identified on chromosome 9. [provided by RefSeq, Oct 2016]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	T	C	6: 128,567,055	N508D	possibly damaging	Het
Ago1	C	T	4: 126,460,569		probably benign	Het
Apol6	A	T	15: 77,051,019	T163S	possibly damaging	Het
Arhgap27	T	C	11: 103,356,269	T33A	probably benign	Het
Atg7	C	A	6: 114,680,236	F132L	possibly damaging	Het
Cep104	C	A	4: 153,988,473	A396E	probably benign	Het
Cers4	T	A	8: 4,518,269	C107*	probably null	Het
Cntn6	T	C	6: 104,848,132	S878P	probably damaging	Het
Dnah6	T	C	6: 73,181,722	K633E	probably benign	Het
Dst	T	A	1: 34,182,891	I2592K	probably benign	Het
Ep400	G	A	5: 110,733,729		probably benign	Het
Fbn1	A	G	2: 125,315,404	C2320R	probably damaging	Het
Gm17677	A	C	9: 35,741,615	D51A	probably damaging	Het
Gpi1	A	G	7: 34,228,926		probably null	Het
Gse1	T	G	8: 120,229,637		probably benign	Het
Hid1	G	A	11: 115,350,948	T612I	possibly damaging	Het
Ighmbp2	G	T	19: 3,265,295	H708Q	probably benign	Het
Igkv10-95	T	C	6: 68,680,589	S10P	probably damaging	Het
Igkv14-100	T	C	6: 68,519,025	V5A	probably benign	Het
Irgq	G	A	7: 24,533,345	G204S	probably damaging	Het
Kansl1	T	C	11: 104,343,637	K681R	possibly damaging	Het
Kcnv1	C	A	15: 45,109,414	V358L	probably damaging	Het
Lrp2	A	T	2: 69,535,005	S275T	probably damaging	Het
Lysmd1	A	T	3: 95,137,908	D155V	probably damaging	Het
Magel2	A	T	7: 62,380,596	I1083F	unknown	Het
Mta3	T	A	17: 83,708,405	V12D	probably damaging	Het
Mtmr4	T	C	11: 87,604,151	I423T	probably damaging	Het
Mup11	A	G	4: 60,660,888	Y16H	possibly damaging	Het
Mycbp	G	A	4: 123,911,096	V91I	probably benign	Het
Ngly1	A	C	14: 16,270,509	Q72P	possibly damaging	Het
Nol4	T	A	18: 22,952,201	Q52L	probably damaging	Het
Nrcam	T	C	12: 44,571,633	V808A	probably damaging	Het
Olfr1058	A	T	2: 86,385,797	L207*	probably null	Het
Olfr9	A	G	10: 128,990,440	H176R	probably damaging	Het
Olfr993	A	T	2: 85,414,165	F238Y	probably damaging	Het
Pik3c2b	C	A	1: 133,088,308	D869E	probably benign	Het
Pom121l2	T	C	13: 21,983,376	S606P	probably damaging	Het
Prdm15	G	A	16: 97,812,570	R517*	probably null	Het
Saraf	T	A	8: 34,165,387	F207I	probably benign	Het
Sema6d	A	G	2: 124,664,708	D874G	probably damaging	Het
Sfrp5	A	T	19: 42,201,972	L14M	unknown	Het
Sidt1	A	T	16: 44,263,312	C485*	probably null	Het
Sptbn4	A	G	7: 27,372,171	Y1618H	probably damaging	Het
Syt14	T	C	1: 192,980,408	Q127R	possibly damaging	Het
Tbc1d2	C	T	4: 46,629,912	G252R	probably benign	Het
Ticrr	G	A	7: 79,660,955	A206T	probably damaging	Het
Tmem132d	T	A	5: 127,784,598	I820F	probably benign	Het
Trafd1	A	G	5: 121,373,457	Y433H	probably damaging	Het
Trim68	A	G	7: 102,678,831	V305A	probably damaging	Het
Vmn2r58	T	A	7: 41,865,056	Y163F	possibly damaging	Het
Vmn2r83	T	A	10: 79,478,792	H291Q	probably benign	Het
Vmn2r95	A	G	17: 18,441,362	I457V	probably benign	Het

Other mutations in Ralgapa1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Ralgapa1	APN	12	55722773	missense	probably damaging	0.98
IGL00494:Ralgapa1	APN	12	55747185	missense	probably damaging	1.00
IGL00731:Ralgapa1	APN	12	55702452	missense	possibly damaging	0.94
IGL00851:Ralgapa1	APN	12	55709575	missense	possibly damaging	0.93
IGL01133:Ralgapa1	APN	12	55642348	missense	probably damaging	1.00
IGL01133:Ralgapa1	APN	12	55642359	missense	probably damaging	0.99
IGL01354:Ralgapa1	APN	12	55777316	missense	possibly damaging	0.68
IGL01514:Ralgapa1	APN	12	55719657	missense	probably damaging	0.97
IGL02033:Ralgapa1	APN	12	55642477	missense	possibly damaging	0.69
IGL02064:Ralgapa1	APN	12	55708077	missense	probably damaging	1.00
IGL02556:Ralgapa1	APN	12	55642449	missense	possibly damaging	0.80
IGL02605:Ralgapa1	APN	12	55712665	missense	possibly damaging	0.90
IGL02657:Ralgapa1	APN	12	55673507	missense	probably damaging	1.00
IGL02676:Ralgapa1	APN	12	55676417	missense	probably damaging	1.00
IGL02894:Ralgapa1	APN	12	55717069	missense	possibly damaging	0.79
IGL02944:Ralgapa1	APN	12	55757951	missense	probably benign	0.01
Anhydrous	UTSW	12	55795778	critical splice acceptor site	probably null
Aqueous	UTSW	12	55698854	missense	probably damaging	1.00
bantam	UTSW	12	55722773	critical splice donor site	probably null
Deliquescent	UTSW	12	55782900	splice site	probably benign
wickedwarlock	UTSW	12	55777292	missense	probably null	0.99
F5770:Ralgapa1	UTSW	12	55795653	splice site	probably benign
IGL03046:Ralgapa1	UTSW	12	55695157	missense	probably damaging	1.00
R0011:Ralgapa1	UTSW	12	55786263	missense	probably damaging	0.99
R0096:Ralgapa1	UTSW	12	55739505	missense	probably damaging	1.00
R0277:Ralgapa1	UTSW	12	55677238	missense	probably damaging	0.99
R0323:Ralgapa1	UTSW	12	55677238	missense	probably damaging	0.99
R0333:Ralgapa1	UTSW	12	55782900	splice site	probably benign
R0361:Ralgapa1	UTSW	12	55676569	missense	possibly damaging	0.93
R0385:Ralgapa1	UTSW	12	55677038	missense	probably damaging	1.00
R0386:Ralgapa1	UTSW	12	55708067	missense	probably benign	0.03
R0498:Ralgapa1	UTSW	12	55689791	missense	possibly damaging	0.66
R0552:Ralgapa1	UTSW	12	55676765	missense	probably benign	0.27
R0564:Ralgapa1	UTSW	12	55782885	missense	possibly damaging	0.84
R0611:Ralgapa1	UTSW	12	55795698	missense	probably damaging	0.99
R0730:Ralgapa1	UTSW	12	55665663	missense	probably damaging	1.00
R0741:Ralgapa1	UTSW	12	55676581	missense	probably damaging	0.99
R0815:Ralgapa1	UTSW	12	55762681	nonsense	probably null
R0815:Ralgapa1	UTSW	12	55782777	splice site	probably benign
R0863:Ralgapa1	UTSW	12	55762681	nonsense	probably null
R0863:Ralgapa1	UTSW	12	55782777	splice site	probably benign
R1068:Ralgapa1	UTSW	12	55790310	critical splice donor site	probably null
R1147:Ralgapa1	UTSW	12	55702480	missense	probably damaging	1.00
R1147:Ralgapa1	UTSW	12	55702480	missense	probably damaging	1.00
R1256:Ralgapa1	UTSW	12	55762661	missense	possibly damaging	0.94
R1343:Ralgapa1	UTSW	12	55707978	missense	probably damaging	1.00
R1378:Ralgapa1	UTSW	12	55676926	missense	probably damaging	1.00
R1474:Ralgapa1	UTSW	12	55741480	missense	probably benign	0.09
R1494:Ralgapa1	UTSW	12	55684524	missense	probably damaging	0.99
R1593:Ralgapa1	UTSW	12	55770703	missense	probably damaging	1.00
R1607:Ralgapa1	UTSW	12	55741536	missense	probably damaging	1.00
R1681:Ralgapa1	UTSW	12	55762603	missense	probably benign	0.35
R1689:Ralgapa1	UTSW	12	55676767	missense	possibly damaging	0.79
R1714:Ralgapa1	UTSW	12	55642389	missense	probably damaging	1.00
R1832:Ralgapa1	UTSW	12	55757967	missense	probably benign	0.03
R1870:Ralgapa1	UTSW	12	55677032	missense	possibly damaging	0.66
R2040:Ralgapa1	UTSW	12	55786322	missense	probably damaging	1.00
R2043:Ralgapa1	UTSW	12	55677026	missense	probably damaging	0.99
R2046:Ralgapa1	UTSW	12	55695160	missense	probably damaging	1.00
R2109:Ralgapa1	UTSW	12	55776188	missense	possibly damaging	0.90
R2114:Ralgapa1	UTSW	12	55786349	critical splice acceptor site	probably null
R2115:Ralgapa1	UTSW	12	55786349	critical splice acceptor site	probably null
R2202:Ralgapa1	UTSW	12	55612800	splice site	probably null
R2203:Ralgapa1	UTSW	12	55612800	splice site	probably null
R2233:Ralgapa1	UTSW	12	55717071	missense	probably benign	0.13
R2235:Ralgapa1	UTSW	12	55717071	missense	probably benign	0.13
R2341:Ralgapa1	UTSW	12	55677124	missense	possibly damaging	0.66
R2507:Ralgapa1	UTSW	12	55718201	missense	probably damaging	1.00
R2508:Ralgapa1	UTSW	12	55718201	missense	probably damaging	1.00
R2972:Ralgapa1	UTSW	12	55820755	missense	possibly damaging	0.61
R3160:Ralgapa1	UTSW	12	55709586	missense	probably damaging	1.00
R3162:Ralgapa1	UTSW	12	55709586	missense	probably damaging	1.00
R3401:Ralgapa1	UTSW	12	55659137	missense	possibly damaging	0.66
R3416:Ralgapa1	UTSW	12	55770613	splice site	probably benign
R3499:Ralgapa1	UTSW	12	55695143	splice site	probably benign
R3799:Ralgapa1	UTSW	12	55659130	missense	probably damaging	1.00
R3948:Ralgapa1	UTSW	12	55698767	missense	probably damaging	1.00
R4039:Ralgapa1	UTSW	12	55795701	missense	probably damaging	0.99
R4120:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4165:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4166:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4212:Ralgapa1	UTSW	12	55739330	critical splice donor site	probably null
R4232:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4233:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4234:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4235:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4399:Ralgapa1	UTSW	12	55795778	critical splice acceptor site	probably null
R4698:Ralgapa1	UTSW	12	55677276	splice site	probably null
R4715:Ralgapa1	UTSW	12	55693458	missense	probably damaging	1.00
R4755:Ralgapa1	UTSW	12	55712748	missense	probably damaging	1.00
R4810:Ralgapa1	UTSW	12	55794993	critical splice donor site	probably null
R4827:Ralgapa1	UTSW	12	55676437	missense	probably damaging	1.00
R4849:Ralgapa1	UTSW	12	55698803	missense	probably damaging	0.99
R4934:Ralgapa1	UTSW	12	55762574	missense	possibly damaging	0.94
R5006:Ralgapa1	UTSW	12	55718114	missense	probably benign	0.02
R5114:Ralgapa1	UTSW	12	55612723	missense	possibly damaging	0.84
R5140:Ralgapa1	UTSW	12	55776152	missense	probably damaging	1.00
R5140:Ralgapa1	UTSW	12	55665674	missense	probably damaging	1.00
R5168:Ralgapa1	UTSW	12	55758032	missense	probably benign	0.05
R5407:Ralgapa1	UTSW	12	55676797	missense	possibly damaging	0.93
R5441:Ralgapa1	UTSW	12	55719623	missense	probably damaging	1.00
R5473:Ralgapa1	UTSW	12	55676710	missense	probably benign	0.41
R5624:Ralgapa1	UTSW	12	55612738	missense	probably damaging	1.00
R5766:Ralgapa1	UTSW	12	55820766	start codon destroyed	probably null	0.99
R5826:Ralgapa1	UTSW	12	55677113	missense	probably damaging	1.00
R5950:Ralgapa1	UTSW	12	55738265	missense	possibly damaging	0.58
R6019:Ralgapa1	UTSW	12	55684042	missense	possibly damaging	0.92
R6065:Ralgapa1	UTSW	12	55757924	critical splice donor site	probably null
R6326:Ralgapa1	UTSW	12	55747146	missense	probably damaging	1.00
R6355:Ralgapa1	UTSW	12	55698854	missense	probably damaging	1.00
R6408:Ralgapa1	UTSW	12	55683910	nonsense	probably null
R6448:Ralgapa1	UTSW	12	55719661	missense	probably benign	0.14
R6453:Ralgapa1	UTSW	12	55738319	missense	probably damaging	1.00
R6590:Ralgapa1	UTSW	12	55722773	critical splice donor site	probably null
R6690:Ralgapa1	UTSW	12	55722773	critical splice donor site	probably null
R6738:Ralgapa1	UTSW	12	55762727	missense	probably damaging	1.00
R6836:Ralgapa1	UTSW	12	55604273	splice site	probably null
R6936:Ralgapa1	UTSW	12	55786212	missense	probably damaging	0.99
R6945:Ralgapa1	UTSW	12	55776191	missense	possibly damaging	0.64
R7028:Ralgapa1	UTSW	12	55758059	missense	probably damaging	1.00
R7075:Ralgapa1	UTSW	12	55820723	missense	possibly damaging	0.66
R7076:Ralgapa1	UTSW	12	55721576	missense	possibly damaging	0.82
R7098:Ralgapa1	UTSW	12	55790310	critical splice donor site	probably null
R7231:Ralgapa1	UTSW	12	55604191	missense	probably damaging	1.00
R7254:Ralgapa1	UTSW	12	55695193	missense	probably damaging	1.00
R7326:Ralgapa1	UTSW	12	55709004	missense	probably damaging	1.00
R7485:Ralgapa1	UTSW	12	55712672	missense	probably damaging	1.00
R7580:Ralgapa1	UTSW	12	55718228	missense	probably benign	0.00
R7677:Ralgapa1	UTSW	12	55659143	missense	probably damaging	0.96
R7702:Ralgapa1	UTSW	12	55709555	missense	probably damaging	1.00
R7702:Ralgapa1	UTSW	12	55709556	missense	probably damaging	1.00
R7707:Ralgapa1	UTSW	12	55777292	missense	probably null	0.99
R7723:Ralgapa1	UTSW	12	55741513	missense	probably benign
R7763:Ralgapa1	UTSW	12	55757955	missense	probably benign	0.28
R7791:Ralgapa1	UTSW	12	55741519	missense	probably damaging	0.97
R7812:Ralgapa1	UTSW	12	55719628	missense	possibly damaging	0.67
R7868:Ralgapa1	UTSW	12	55612638	missense	probably benign	0.00
R7895:Ralgapa1	UTSW	12	55747149	missense	probably benign	0.44
R7896:Ralgapa1	UTSW	12	55697878	missense	probably benign	0.01
R8004:Ralgapa1	UTSW	12	55702457	missense	probably damaging	0.99
R8094:Ralgapa1	UTSW	12	55782846	missense	probably damaging	0.99
R8213:Ralgapa1	UTSW	12	55722914	missense	probably damaging	0.99
R8307:Ralgapa1	UTSW	12	55741523	missense	probably damaging	0.99
R8423:Ralgapa1	UTSW	12	55659062	missense	probably damaging	0.99
R8462:Ralgapa1	UTSW	12	55676518	missense	possibly damaging	0.90
R8469:Ralgapa1	UTSW	12	55739413	missense	probably damaging	1.00
R8675:Ralgapa1	UTSW	12	55738217	missense	possibly damaging	0.93
R8802:Ralgapa1	UTSW	12	55738316	missense	probably damaging	0.99
R8937:Ralgapa1	UTSW	12	55702560	missense	probably damaging	0.96
R8953:Ralgapa1	UTSW	12	55820761	missense	probably damaging	0.99
R8974:Ralgapa1	UTSW	12	55677006	missense	probably benign
R9011:Ralgapa1	UTSW	12	55605529	intron	probably benign
R9089:Ralgapa1	UTSW	12	55676566	missense	probably damaging	0.97
R9124:Ralgapa1	UTSW	12	55735096	missense	probably damaging	1.00
R9254:Ralgapa1	UTSW	12	55722798	missense	probably damaging	1.00
R9320:Ralgapa1	UTSW	12	55709058	missense	possibly damaging	0.59
R9379:Ralgapa1	UTSW	12	55722798	missense	probably damaging	1.00
R9446:Ralgapa1	UTSW	12	55708023	missense	probably damaging	0.97
R9684:Ralgapa1	UTSW	12	55612700	missense	possibly damaging	0.63
Z1176:Ralgapa1	UTSW	12	55709080	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCAGTAGAGCATGTGTTTAGCATG -3'
(R):5'- AGACAAGTCTGCAGAGCCTG -3'

Sequencing Primer
(F):5'- GCATGTGTTTAGCATGCACAAAGC -3'
(R):5'- TGCAGAGCCTGAGCAGTCTC -3'

Posted On

2017-06-27