Mutagenetix > Incidental Mutation

Incidental Mutation 'R5980:Atg7'

481377

Institutional Source

Beutler Lab

Gene Symbol

Atg7

Ensembl Gene

ENSMUSG00000030314

Gene Name

autophagy related 7

Synonyms

1810013K23Rik, Apg7l

MMRRC Submission

044162-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5980 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

114643097-114860614 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 114680236 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 132 (F132L)

Ref Sequence

ENSEMBL: ENSMUSP00000138300 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032457] [ENSMUST00000169310] [ENSMUST00000182034] [ENSMUST00000182035] [ENSMUST00000182169] [ENSMUST00000182428] [ENSMUST00000182510] [ENSMUST00000182793] [ENSMUST00000182902] [ENSMUST00000183165]

AlphaFold

Q9D906

Predicted Effect

probably benign
Transcript: ENSMUST00000032457
AA Change: F132L

PolyPhen 2 Score 0.445 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000032457
Gene: ENSMUSG00000030314
AA Change: F132L

Domain	Start	End	E-Value	Type
Pfam:ThiF	350	506	1.6e-38	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000169310
AA Change: F175L

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000133215
Gene: ENSMUSG00000030314
AA Change: F175L

Domain	Start	End	E-Value	Type
Pfam:ATG7_N	9	319	1.5e-106	PFAM
Pfam:ThiF	329	643	7.9e-61	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000182034
AA Change: F148L

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000138358
Gene: ENSMUSG00000030314
AA Change: F148L

Domain	Start	End	E-Value	Type
PDB:3VX8\|A	25	231	1e-39	PDB

Predicted Effect

possibly damaging
Transcript: ENSMUST00000182035
AA Change: F132L

PolyPhen 2 Score 0.695 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000138731
Gene: ENSMUSG00000030314
AA Change: F132L

Domain	Start	End	E-Value	Type
PDB:3VX8\|A	9	222	9e-40	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000182169

SMART Domains

Protein: ENSMUSP00000138404
Gene: ENSMUSG00000030314

Domain	Start	End	E-Value	Type
PDB:3VX8\|A	32	110	2e-9	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000182428
AA Change: F132L

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000138779
Gene: ENSMUSG00000030314
AA Change: F132L

Domain	Start	End	E-Value	Type
Pfam:ThiF	350	506	1.1e-37	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000182510
AA Change: F132L

PolyPhen 2 Score 0.798 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000138300
Gene: ENSMUSG00000030314
AA Change: F132L

Domain	Start	End	E-Value	Type
PDB:3VX8\|A	9	159	8e-37	PDB

Predicted Effect

probably benign
Transcript: ENSMUST00000182793
AA Change: F132L

PolyPhen 2 Score 0.445 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000138137
Gene: ENSMUSG00000030314
AA Change: F132L

Domain	Start	End	E-Value	Type
Pfam:ThiF	350	506	1.6e-38	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000182902
AA Change: F132L

PolyPhen 2 Score 0.445 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000138651
Gene: ENSMUSG00000030314
AA Change: F132L

Domain	Start	End	E-Value	Type
Pfam:ThiF	350	506	1.6e-38	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183127

Predicted Effect

probably benign
Transcript: ENSMUST00000183165
AA Change: F132L

PolyPhen 2 Score 0.445 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000138600
Gene: ENSMUSG00000030314
AA Change: F132L

Domain	Start	End	E-Value	Type
Pfam:ThiF	311	467	9.7e-38	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203130

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204593

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.2%

Validation Efficiency

96% (50/52)

MGI Phenotype

FUNCTION: This gene encodes an E1-like activating enzyme that is essential for autophagy and cytoplasmic to vacuole transport. The encoded protein is also thought to modulate p53-dependent cell cycle pathways during prolonged metabolic stress. It has been associated with multiple functions, including axon membrane trafficking, axonal homeostasis, mitophagy, adipose differentiation, and hematopoietic stem cell maintenance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutation of this gene causes impairment of constitutive and starvation-induced autophagy resulting in defective protein degradation. Homozygous null mice die within 1 day of birth and have decreased body weight. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2ml1	T	C	6: 128,567,055	N508D	possibly damaging	Het
Ago1	C	T	4: 126,460,569		probably benign	Het
Apol6	A	T	15: 77,051,019	T163S	possibly damaging	Het
Arhgap27	T	C	11: 103,356,269	T33A	probably benign	Het
Cep104	C	A	4: 153,988,473	A396E	probably benign	Het
Cers4	T	A	8: 4,518,269	C107*	probably null	Het
Cntn6	T	C	6: 104,848,132	S878P	probably damaging	Het
Dnah6	T	C	6: 73,181,722	K633E	probably benign	Het
Dst	T	A	1: 34,182,891	I2592K	probably benign	Het
Ep400	G	A	5: 110,733,729		probably benign	Het
Fbn1	A	G	2: 125,315,404	C2320R	probably damaging	Het
Gm17677	A	C	9: 35,741,615	D51A	probably damaging	Het
Gpi1	A	G	7: 34,228,926		probably null	Het
Gse1	T	G	8: 120,229,637		probably benign	Het
Hid1	G	A	11: 115,350,948	T612I	possibly damaging	Het
Ighmbp2	G	T	19: 3,265,295	H708Q	probably benign	Het
Igkv10-95	T	C	6: 68,680,589	S10P	probably damaging	Het
Igkv14-100	T	C	6: 68,519,025	V5A	probably benign	Het
Irgq	G	A	7: 24,533,345	G204S	probably damaging	Het
Kansl1	T	C	11: 104,343,637	K681R	possibly damaging	Het
Kcnv1	C	A	15: 45,109,414	V358L	probably damaging	Het
Lrp2	A	T	2: 69,535,005	S275T	probably damaging	Het
Lysmd1	A	T	3: 95,137,908	D155V	probably damaging	Het
Magel2	A	T	7: 62,380,596	I1083F	unknown	Het
Mta3	T	A	17: 83,708,405	V12D	probably damaging	Het
Mtmr4	T	C	11: 87,604,151	I423T	probably damaging	Het
Mup11	A	G	4: 60,660,888	Y16H	possibly damaging	Het
Mycbp	G	A	4: 123,911,096	V91I	probably benign	Het
Ngly1	A	C	14: 16,270,509	Q72P	possibly damaging	Het
Nol4	T	A	18: 22,952,201	Q52L	probably damaging	Het
Nrcam	T	C	12: 44,571,633	V808A	probably damaging	Het
Olfr1058	A	T	2: 86,385,797	L207*	probably null	Het
Olfr9	A	G	10: 128,990,440	H176R	probably damaging	Het
Olfr993	A	T	2: 85,414,165	F238Y	probably damaging	Het
Pik3c2b	C	A	1: 133,088,308	D869E	probably benign	Het
Pom121l2	T	C	13: 21,983,376	S606P	probably damaging	Het
Prdm15	G	A	16: 97,812,570	R517*	probably null	Het
Ralgapa1	T	A	12: 55,770,616		probably null	Het
Saraf	T	A	8: 34,165,387	F207I	probably benign	Het
Sema6d	A	G	2: 124,664,708	D874G	probably damaging	Het
Sfrp5	A	T	19: 42,201,972	L14M	unknown	Het
Sidt1	A	T	16: 44,263,312	C485*	probably null	Het
Sptbn4	A	G	7: 27,372,171	Y1618H	probably damaging	Het
Syt14	T	C	1: 192,980,408	Q127R	possibly damaging	Het
Tbc1d2	C	T	4: 46,629,912	G252R	probably benign	Het
Ticrr	G	A	7: 79,660,955	A206T	probably damaging	Het
Tmem132d	T	A	5: 127,784,598	I820F	probably benign	Het
Trafd1	A	G	5: 121,373,457	Y433H	probably damaging	Het
Trim68	A	G	7: 102,678,831	V305A	probably damaging	Het
Vmn2r58	T	A	7: 41,865,056	Y163F	possibly damaging	Het
Vmn2r83	T	A	10: 79,478,792	H291Q	probably benign	Het
Vmn2r95	A	G	17: 18,441,362	I457V	probably benign	Het

Other mutations in Atg7

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02969:Atg7	APN	6	114724923	missense	possibly damaging	0.71
R1460:Atg7	UTSW	6	114703364	missense	probably damaging	0.99
R1467:Atg7	UTSW	6	114858982	splice site	probably benign
R1561:Atg7	UTSW	6	114701172	missense	possibly damaging	0.52
R1755:Atg7	UTSW	6	114673677	missense	possibly damaging	0.64
R1934:Atg7	UTSW	6	114701235	missense	probably damaging	0.98
R1962:Atg7	UTSW	6	114706230	missense	probably damaging	1.00
R1964:Atg7	UTSW	6	114706230	missense	probably damaging	1.00
R2064:Atg7	UTSW	6	114703363	missense	probably damaging	1.00
R3722:Atg7	UTSW	6	114695663	missense	probably damaging	0.99
R3870:Atg7	UTSW	6	114697047	missense	possibly damaging	0.71
R3926:Atg7	UTSW	6	114673678	missense	possibly damaging	0.81
R4044:Atg7	UTSW	6	114701978	missense	probably benign	0.00
R4111:Atg7	UTSW	6	114713294	missense	probably damaging	0.98
R4212:Atg7	UTSW	6	114703425	missense	probably benign	0.02
R4943:Atg7	UTSW	6	114697084	missense	probably benign	0.25
R5216:Atg7	UTSW	6	114724949	missense	probably damaging	0.96
R5465:Atg7	UTSW	6	114652532	missense	probably benign
R5555:Atg7	UTSW	6	114702053	missense	probably damaging	1.00
R5618:Atg7	UTSW	6	114673699	missense	probably damaging	0.99
R5902:Atg7	UTSW	6	114673678	missense	possibly damaging	0.81
R5903:Atg7	UTSW	6	114706293	nonsense	probably null
R6031:Atg7	UTSW	6	114671233	missense	probably benign	0.01
R6031:Atg7	UTSW	6	114671233	missense	probably benign	0.01
R6178:Atg7	UTSW	6	114724895	missense	probably damaging	1.00
R6702:Atg7	UTSW	6	114671097	splice site	probably null
R6924:Atg7	UTSW	6	114709211	critical splice donor site	probably null
R6941:Atg7	UTSW	6	114673678	missense	possibly damaging	0.81
R7201:Atg7	UTSW	6	114777057	missense	probably damaging	1.00
R7561:Atg7	UTSW	6	114673041	missense	possibly damaging	0.80
R8070:Atg7	UTSW	6	114697080	missense	probably benign	0.03
R8170:Atg7	UTSW	6	114701190	missense	probably benign	0.11
R8329:Atg7	UTSW	6	114686096	missense	possibly damaging	0.70
R8367:Atg7	UTSW	6	114686099	missense	probably benign
R9084:Atg7	UTSW	6	114701935	missense	probably damaging	1.00
R9221:Atg7	UTSW	6	114695627	missense	possibly damaging	0.94
R9411:Atg7	UTSW	6	114713328	missense	probably benign	0.41
R9622:Atg7	UTSW	6	114678032	missense	probably benign	0.00
Z1088:Atg7	UTSW	6	114695686	missense	probably benign	0.15
Z1176:Atg7	UTSW	6	114673050	missense	possibly damaging	0.89

Predicted Primers

PCR Primer
(F):5'- ACTTCAGCGTCTGAGAGCAG -3'
(R):5'- AGGAGTTGTTAGGTCACCATG -3'

Sequencing Primer
(F):5'- CGTCTGAGAGCAGTGGCAG -3'
(R):5'- CCATGTTTGAGAAATTATACGGTGGC -3'

Posted On

2017-06-26