Incidental Mutation 'R6702:Atg7'
ID 543536
Institutional Source Beutler Lab
Gene Symbol Atg7
Ensembl Gene ENSMUSG00000030314
Gene Name autophagy related 7
Synonyms 1810013K23Rik, Apg7l
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6702 (G1)
Quality Score 221.009
Status Validated
Chromosome 6
Chromosomal Location 114643097-114860614 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) C to A at 114671097 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032457] [ENSMUST00000169310] [ENSMUST00000182034] [ENSMUST00000182035] [ENSMUST00000182098] [ENSMUST00000182169] [ENSMUST00000182428] [ENSMUST00000182510] [ENSMUST00000182771] [ENSMUST00000182793] [ENSMUST00000182902] [ENSMUST00000183165]
AlphaFold Q9D906
Predicted Effect probably benign
Transcript: ENSMUST00000032457
SMART Domains Protein: ENSMUSP00000032457
Gene: ENSMUSG00000030314

DomainStartEndE-ValueType
Pfam:ThiF 350 506 1.6e-38 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000169310
SMART Domains Protein: ENSMUSP00000133215
Gene: ENSMUSG00000030314

DomainStartEndE-ValueType
Pfam:ATG7_N 9 319 1.5e-106 PFAM
Pfam:ThiF 329 643 7.9e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182034
SMART Domains Protein: ENSMUSP00000138358
Gene: ENSMUSG00000030314

DomainStartEndE-ValueType
PDB:3VX8|A 25 231 1e-39 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000182035
SMART Domains Protein: ENSMUSP00000138731
Gene: ENSMUSG00000030314

DomainStartEndE-ValueType
PDB:3VX8|A 9 222 9e-40 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000182098
Predicted Effect probably benign
Transcript: ENSMUST00000182169
SMART Domains Protein: ENSMUSP00000138404
Gene: ENSMUSG00000030314

DomainStartEndE-ValueType
PDB:3VX8|A 32 110 2e-9 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000182428
SMART Domains Protein: ENSMUSP00000138779
Gene: ENSMUSG00000030314

DomainStartEndE-ValueType
Pfam:ThiF 350 506 1.1e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182510
SMART Domains Protein: ENSMUSP00000138300
Gene: ENSMUSG00000030314

DomainStartEndE-ValueType
PDB:3VX8|A 9 159 8e-37 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000182771
SMART Domains Protein: ENSMUSP00000138374
Gene: ENSMUSG00000030314

DomainStartEndE-ValueType
PDB:3VX8|A 9 47 7e-8 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000182793
SMART Domains Protein: ENSMUSP00000138137
Gene: ENSMUSG00000030314

DomainStartEndE-ValueType
Pfam:ThiF 350 506 1.6e-38 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000182902
SMART Domains Protein: ENSMUSP00000138651
Gene: ENSMUSG00000030314

DomainStartEndE-ValueType
Pfam:ThiF 350 506 1.6e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183165
SMART Domains Protein: ENSMUSP00000138600
Gene: ENSMUSG00000030314

DomainStartEndE-ValueType
Pfam:ThiF 311 467 9.7e-38 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.5%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: This gene encodes an E1-like activating enzyme that is essential for autophagy and cytoplasmic to vacuole transport. The encoded protein is also thought to modulate p53-dependent cell cycle pathways during prolonged metabolic stress. It has been associated with multiple functions, including axon membrane trafficking, axonal homeostasis, mitophagy, adipose differentiation, and hematopoietic stem cell maintenance. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mutation of this gene causes impairment of constitutive and starvation-induced autophagy resulting in defective protein degradation. Homozygous null mice die within 1 day of birth and have decreased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700020N01Rik T A 10: 21,621,659 Y66* probably null Het
2810474O19Rik T A 6: 149,327,878 N807K probably damaging Het
Ak3 A G 19: 29,026,227 V183A probably damaging Het
Ano10 G T 9: 122,259,564 Q397K possibly damaging Het
Brpf3 A C 17: 28,810,659 N531T probably benign Het
Casp2 T C 6: 42,268,051 V128A probably benign Het
Cdcp2 T C 4: 107,107,086 C378R probably benign Het
Cfap54 T A 10: 92,868,734 D2828V unknown Het
Col6a3 T C 1: 90,779,439 D1984G unknown Het
Csnk2a1 A G 2: 152,258,688 T93A probably benign Het
Ddx54 T A 5: 120,626,503 D758E possibly damaging Het
Dlx2 A G 2: 71,546,227 S56P probably damaging Het
Dna2 T A 10: 62,973,294 I1055N possibly damaging Het
Dnah10 A G 5: 124,805,805 Y2909C probably damaging Het
Dnm3 A G 1: 162,318,687 F296L probably benign Het
Fat1 A G 8: 44,953,046 T945A probably benign Het
Herpud1 T C 8: 94,392,526 probably null Het
Iqub T A 6: 24,449,745 N707I probably damaging Het
Kif26b C G 1: 178,917,287 S1649R possibly damaging Het
Lamp5 C G 2: 136,059,563 N102K possibly damaging Het
Ltbr A G 6: 125,308,068 S290P probably benign Het
Map4k1 T G 7: 29,002,396 S803A possibly damaging Het
Mef2c T A 13: 83,625,406 C134S possibly damaging Het
Myo15 A G 11: 60,492,992 I1622V probably benign Het
Nbea A G 3: 56,005,502 Y955H probably benign Het
Ndor1 A G 2: 25,249,890 F142S possibly damaging Het
Nynrin A G 14: 55,864,478 T535A possibly damaging Het
Olfr1176 G A 2: 88,340,242 V226I probably benign Het
Olfr1290 T A 2: 111,490,109 probably null Het
Olfr205 C T 16: 59,328,598 V304I probably benign Het
Olfr727 A G 14: 50,127,231 Y218C probably damaging Het
Olfr916 A T 9: 38,657,777 I205N possibly damaging Het
Pcdhb13 T G 18: 37,444,775 H735Q probably benign Het
Pcdhb7 A T 18: 37,341,906 M32L probably benign Het
Peg10 GC GCTCC 6: 4,756,452 probably benign Het
Per2 C T 1: 91,427,949 E696K probably damaging Het
Pld4 T C 12: 112,765,051 S213P probably damaging Het
Prkg1 T A 19: 30,993,084 H209L probably benign Het
Psg16 T C 7: 17,090,396 L35P probably damaging Het
Pxn C T 5: 115,551,896 L160F probably benign Het
Rab3a A G 8: 70,756,448 D77G probably damaging Het
Rgma A T 7: 73,417,320 T108S probably damaging Het
Rxrg A G 1: 167,613,805 S51G probably benign Het
S1pr3 A T 13: 51,419,439 I219F probably damaging Het
Sec23b A T 2: 144,559,189 probably null Het
Sfrp5 G T 19: 42,201,827 T62K probably benign Het
Slco1a6 T A 6: 142,103,100 Y318F probably damaging Het
Slit1 A C 19: 41,614,870 S931A possibly damaging Het
Sorl1 A T 9: 42,071,201 V361E probably damaging Het
St6galnac2 A G 11: 116,684,387 S209P probably benign Het
Supt6 C A 11: 78,231,800 R199L possibly damaging Het
Tas2r107 A C 6: 131,659,384 M234R probably benign Het
Tmem72 C G 6: 116,698,349 V61L probably benign Het
Trpm5 C A 7: 143,069,318 probably benign Het
Ttn T G 2: 76,720,112 T23282P probably damaging Het
Ubap2 GCCCGCTTGCCCCGCT GCCCGCTTGCCCCGCTTGCCCCGCT 4: 41,227,210 probably benign Het
Ubr3 A T 2: 69,956,049 R836W probably benign Het
Umodl1 A G 17: 30,986,299 probably null Het
Ythdf1 A G 2: 180,919,133 probably null Het
Zfp780b T C 7: 27,971,641 T81A possibly damaging Het
Zfp811 T C 17: 32,797,842 E407G probably damaging Het
Other mutations in Atg7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02969:Atg7 APN 6 114724923 missense possibly damaging 0.71
R1460:Atg7 UTSW 6 114703364 missense probably damaging 0.99
R1467:Atg7 UTSW 6 114858982 splice site probably benign
R1561:Atg7 UTSW 6 114701172 missense possibly damaging 0.52
R1755:Atg7 UTSW 6 114673677 missense possibly damaging 0.64
R1934:Atg7 UTSW 6 114701235 missense probably damaging 0.98
R1962:Atg7 UTSW 6 114706230 missense probably damaging 1.00
R1964:Atg7 UTSW 6 114706230 missense probably damaging 1.00
R2064:Atg7 UTSW 6 114703363 missense probably damaging 1.00
R3722:Atg7 UTSW 6 114695663 missense probably damaging 0.99
R3870:Atg7 UTSW 6 114697047 missense possibly damaging 0.71
R3926:Atg7 UTSW 6 114673678 missense possibly damaging 0.81
R4044:Atg7 UTSW 6 114701978 missense probably benign 0.00
R4111:Atg7 UTSW 6 114713294 missense probably damaging 0.98
R4212:Atg7 UTSW 6 114703425 missense probably benign 0.02
R4943:Atg7 UTSW 6 114697084 missense probably benign 0.25
R5216:Atg7 UTSW 6 114724949 missense probably damaging 0.96
R5465:Atg7 UTSW 6 114652532 missense probably benign
R5555:Atg7 UTSW 6 114702053 missense probably damaging 1.00
R5618:Atg7 UTSW 6 114673699 missense probably damaging 0.99
R5902:Atg7 UTSW 6 114673678 missense possibly damaging 0.81
R5903:Atg7 UTSW 6 114706293 nonsense probably null
R5980:Atg7 UTSW 6 114680236 missense possibly damaging 0.80
R6031:Atg7 UTSW 6 114671233 missense probably benign 0.01
R6031:Atg7 UTSW 6 114671233 missense probably benign 0.01
R6178:Atg7 UTSW 6 114724895 missense probably damaging 1.00
R6924:Atg7 UTSW 6 114709211 critical splice donor site probably null
R6941:Atg7 UTSW 6 114673678 missense possibly damaging 0.81
R7201:Atg7 UTSW 6 114777057 missense probably damaging 1.00
R7561:Atg7 UTSW 6 114673041 missense possibly damaging 0.80
R8070:Atg7 UTSW 6 114697080 missense probably benign 0.03
R8170:Atg7 UTSW 6 114701190 missense probably benign 0.11
R8329:Atg7 UTSW 6 114686096 missense possibly damaging 0.70
R8367:Atg7 UTSW 6 114686099 missense probably benign
R9084:Atg7 UTSW 6 114701935 missense probably damaging 1.00
R9221:Atg7 UTSW 6 114695627 missense possibly damaging 0.94
R9411:Atg7 UTSW 6 114713328 missense probably benign 0.41
R9622:Atg7 UTSW 6 114678032 missense probably benign 0.00
Z1088:Atg7 UTSW 6 114695686 missense probably benign 0.15
Z1176:Atg7 UTSW 6 114673050 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AATAATCCTGGGCCATATTGGG -3'
(R):5'- TACCATGCTTGTGAACCACG -3'

Sequencing Primer
(F):5'- GCAAGTCAGCCCATATTGGTG -3'
(R):5'- TTGTGAACCACGCATGTGC -3'
Posted On 2019-02-22