Incidental Mutation 'R6057:Dmgdh'
ID482998
Institutional Source Beutler Lab
Gene Symbol Dmgdh
Ensembl Gene ENSMUSG00000042102
Gene Namedimethylglycine dehydrogenase precursor
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6057 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location93674433-93752833 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 93752452 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 866 (T866I)
Ref Sequence ENSEMBL: ENSMUSP00000039663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048001]
Predicted Effect probably benign
Transcript: ENSMUST00000048001
AA Change: T866I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000039663
Gene: ENSMUSG00000042102
AA Change: T866I

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:DAO 44 407 9.3e-64 PFAM
Pfam:FAO_M 410 464 1e-15 PFAM
Pfam:GCV_T 468 738 3.6e-72 PFAM
Pfam:SoxG 559 697 1.3e-10 PFAM
Pfam:GCV_T_C 745 838 3.9e-26 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes an enzyme involved in the catabolism of choline, catalyzing the oxidative demethylation of dimethylglycine to form sarcosine. The enzyme is found as a monomer in the mitochondrial matrix, and uses flavin adenine dinucleotide and folate as cofactors. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik A G 6: 52,179,520 probably benign Het
Acan A G 7: 79,099,782 S11G probably null Het
Ankrd13d A C 19: 4,282,228 V56G probably damaging Het
Arl15 A G 13: 113,967,615 Y76C probably damaging Het
Aspg G A 12: 112,120,998 C296Y probably damaging Het
Astl T A 2: 127,345,969 D101E probably benign Het
Bmpr2 A G 1: 59,842,818 N202S probably benign Het
Borcs7 T C 19: 46,701,564 *106Q probably null Het
Brip1 A G 11: 86,065,039 S883P possibly damaging Het
Cacng2 A T 15: 78,118,791 L34Q probably damaging Het
Catip A C 1: 74,362,918 D84A probably damaging Het
Ccdc162 A G 10: 41,634,041 L856S possibly damaging Het
Ccdc38 A G 10: 93,581,746 K500E probably damaging Het
Ccser2 T C 14: 36,941,165 K21E probably damaging Het
Cd93 A T 2: 148,441,519 Y636N probably damaging Het
Cep128 A T 12: 91,296,224 N300K possibly damaging Het
Cfap44 A G 16: 44,449,097 T1155A probably benign Het
Clec16a T C 16: 10,630,087 L550P probably damaging Het
Csmd3 T C 15: 47,755,391 Y1867C probably damaging Het
Cul3 A T 1: 80,271,532 I674N probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp2d34 T C 15: 82,616,351 H429R probably benign Het
Dab2ip T A 2: 35,692,255 C4* probably null Het
Dcaf1 A G 9: 106,854,247 E641G probably damaging Het
Dda1 T A 8: 71,474,632 probably benign Het
Ect2l T C 10: 18,161,502 T383A probably benign Het
Ets2 A G 16: 95,714,372 N181D probably benign Het
Ezh2 A G 6: 47,552,423 F222L probably damaging Het
Frem3 T C 8: 80,615,587 L1503P probably damaging Het
Fsip2 C A 2: 82,979,433 A2032E probably damaging Het
Gm1818 C T 12: 48,555,563 noncoding transcript Het
Gm9493 A G 19: 23,619,742 S1G probably damaging Het
Grin2b A G 6: 135,733,944 I868T possibly damaging Het
Ift22 A T 5: 136,911,133 T17S possibly damaging Het
Il4ra T C 7: 125,571,563 W216R probably damaging Het
Kcnj6 A T 16: 94,832,377 W274R probably damaging Het
Kctd19 G A 8: 105,396,450 H111Y probably damaging Het
Kremen2 A G 17: 23,742,705 V276A probably benign Het
Lig1 C A 7: 13,288,672 Q143K probably damaging Het
Lrp1 A T 10: 127,567,490 D2071E probably damaging Het
Macf1 C T 4: 123,510,743 M475I probably damaging Het
Mbtd1 G A 11: 93,929,659 A427T probably damaging Het
Myof A G 19: 37,926,981 probably null Het
Nbeal2 T C 9: 110,641,877 D308G possibly damaging Het
Ncdn T C 4: 126,745,031 Q665R probably benign Het
Nkd1 T C 8: 88,589,814 probably null Het
Nktr G A 9: 121,748,389 probably benign Het
Npc1l1 A T 11: 6,217,806 M995K possibly damaging Het
Olfr1129 C A 2: 87,576,019 R312S probably benign Het
Olfr300-ps1 T A 7: 86,443,189 C69* probably null Het
Olfr740 A T 14: 50,453,744 R231* probably null Het
Padi4 T C 4: 140,760,040 T184A probably damaging Het
Pgm2l1 C T 7: 100,266,674 P409S probably benign Het
Pgpep1 G A 8: 70,652,451 T53M probably damaging Het
Pgr T C 9: 8,902,005 L513P probably damaging Het
Pikfyve T A 1: 65,272,571 I1989N probably damaging Het
Prrc2a T C 17: 35,152,740 T1806A probably benign Het
Psd T C 19: 46,323,314 E309G possibly damaging Het
Qtrt1 C T 9: 21,412,003 T50I probably damaging Het
Rims2 A C 15: 39,675,020 T1320P probably damaging Het
Scn11a T G 9: 119,765,448 N1293T probably damaging Het
Scn8a T C 15: 100,974,667 F529S possibly damaging Het
Sec14l4 A T 11: 4,035,142 D25V possibly damaging Het
Sema3a C T 5: 13,565,865 R419C probably damaging Het
Slc12a1 T C 2: 125,190,213 Y595H probably damaging Het
Slc25a28 A T 19: 43,666,925 H170Q possibly damaging Het
Slc26a1 T A 5: 108,673,765 Q86L probably damaging Het
Slc48a1 T A 15: 97,789,917 W51R probably damaging Het
Sptlc3 T A 2: 139,581,613 V309D probably damaging Het
Srcap G A 7: 127,541,356 S1375N probably damaging Het
Tanc1 C A 2: 59,817,493 H986Q possibly damaging Het
Tbc1d4 A G 14: 101,489,917 V486A probably damaging Het
Tceanc2 T C 4: 107,147,579 D124G probably damaging Het
Tdrd9 A G 12: 112,013,286 M402V possibly damaging Het
Tmem132d T C 5: 127,784,870 D729G probably damaging Het
Tmem62 T A 2: 120,977,462 I55N probably damaging Het
Tnfrsf21 A T 17: 43,039,715 N257Y possibly damaging Het
Trappc3 T C 4: 126,274,041 L131P probably damaging Het
Vmn2r25 A T 6: 123,822,941 M814K possibly damaging Het
Vmn2r87 T C 10: 130,472,357 I671V probably benign Het
Vwa8 A T 14: 79,082,873 D1108V probably benign Het
Xrcc4 C G 13: 89,991,079 A241P possibly damaging Het
Xylt1 T A 7: 117,591,908 D310E probably benign Het
Zfp27 T G 7: 29,895,019 H507P possibly damaging Het
Zfp341 C T 2: 154,625,034 P108S probably benign Het
Zfp641 T C 15: 98,292,935 N76S probably benign Het
Zfp936 T C 7: 43,190,363 V418A probably benign Het
Other mutations in Dmgdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01080:Dmgdh APN 13 93703778 splice site probably benign
IGL01406:Dmgdh APN 13 93687031 splice site probably benign
IGL01408:Dmgdh APN 13 93709295 missense probably damaging 1.00
IGL02167:Dmgdh APN 13 93720627 splice site probably benign
IGL02538:Dmgdh APN 13 93708753 missense possibly damaging 0.50
IGL02550:Dmgdh APN 13 93717575 missense probably damaging 1.00
IGL02563:Dmgdh APN 13 93674539 splice site probably benign
IGL02668:Dmgdh APN 13 93703910 missense probably damaging 1.00
IGL02889:Dmgdh APN 13 93715677 critical splice donor site probably null
IGL03293:Dmgdh APN 13 93706701 missense probably benign 0.11
R0646:Dmgdh UTSW 13 93752355 missense probably benign 0.04
R1531:Dmgdh UTSW 13 93744411 missense probably damaging 1.00
R1746:Dmgdh UTSW 13 93752425 missense probably benign
R1795:Dmgdh UTSW 13 93706699 missense probably benign
R1943:Dmgdh UTSW 13 93711370 missense probably benign 0.08
R1959:Dmgdh UTSW 13 93720559 missense probably benign 0.01
R3421:Dmgdh UTSW 13 93711361 missense probably benign 0.01
R3727:Dmgdh UTSW 13 93692067 missense probably damaging 1.00
R4523:Dmgdh UTSW 13 93688630 nonsense probably null
R5000:Dmgdh UTSW 13 93688538 missense probably damaging 1.00
R5589:Dmgdh UTSW 13 93677157 missense probably damaging 1.00
R5913:Dmgdh UTSW 13 93752323 missense possibly damaging 0.92
R6056:Dmgdh UTSW 13 93708743 missense possibly damaging 0.67
R6056:Dmgdh UTSW 13 93752326 missense probably damaging 1.00
R6180:Dmgdh UTSW 13 93752286 missense possibly damaging 0.61
R6259:Dmgdh UTSW 13 93752308 missense probably benign 0.01
R6608:Dmgdh UTSW 13 93706744 missense possibly damaging 0.81
R6636:Dmgdh UTSW 13 93709198 missense probably benign 0.08
R6637:Dmgdh UTSW 13 93709198 missense probably benign 0.08
R6739:Dmgdh UTSW 13 93720615 missense probably benign 0.07
R7157:Dmgdh UTSW 13 93715535 missense probably damaging 1.00
R7200:Dmgdh UTSW 13 93691885 missense probably damaging 1.00
R7312:Dmgdh UTSW 13 93708846 splice site probably null
R7349:Dmgdh UTSW 13 93752233 missense possibly damaging 0.80
R8087:Dmgdh UTSW 13 93703871 missense possibly damaging 0.95
R8288:Dmgdh UTSW 13 93708824 missense probably damaging 1.00
R8290:Dmgdh UTSW 13 93706736 missense probably benign 0.05
R8371:Dmgdh UTSW 13 93708730 missense probably benign 0.00
R8469:Dmgdh UTSW 13 93706667 missense probably damaging 1.00
R8768:Dmgdh UTSW 13 93688610 missense possibly damaging 0.52
X0066:Dmgdh UTSW 13 93752374 missense possibly damaging 0.90
Z1177:Dmgdh UTSW 13 93677183 missense probably damaging 0.96
Z1177:Dmgdh UTSW 13 93709288 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGTCCCAGTCCAGCTCAG -3'
(R):5'- TTCTCTGACTGGGTTTCATAAACG -3'

Posted On2017-07-14