Incidental Mutation 'R6057:Tmem132d'
ID482958
Institutional Source Beutler Lab
Gene Symbol Tmem132d
Ensembl Gene ENSMUSG00000034310
Gene Nametransmembrane protein 132D
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R6057 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location127781630-128433077 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 127784870 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 729 (D729G)
Ref Sequence ENSEMBL: ENSMUSP00000043633 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044441]
Predicted Effect probably damaging
Transcript: ENSMUST00000044441
AA Change: D729G

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000043633
Gene: ENSMUSG00000034310
AA Change: D729G

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
Pfam:TMEM132D_N 49 178 1.9e-59 PFAM
Pfam:TMEM132 435 778 3.9e-150 PFAM
Pfam:TMEM132D_C 884 970 1.9e-37 PFAM
low complexity region 998 1011 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik A G 6: 52,179,520 probably benign Het
Acan A G 7: 79,099,782 S11G probably null Het
Ankrd13d A C 19: 4,282,228 V56G probably damaging Het
Arl15 A G 13: 113,967,615 Y76C probably damaging Het
Aspg G A 12: 112,120,998 C296Y probably damaging Het
Astl T A 2: 127,345,969 D101E probably benign Het
Bmpr2 A G 1: 59,842,818 N202S probably benign Het
Borcs7 T C 19: 46,701,564 *106Q probably null Het
Brip1 A G 11: 86,065,039 S883P possibly damaging Het
Cacng2 A T 15: 78,118,791 L34Q probably damaging Het
Catip A C 1: 74,362,918 D84A probably damaging Het
Ccdc162 A G 10: 41,634,041 L856S possibly damaging Het
Ccdc38 A G 10: 93,581,746 K500E probably damaging Het
Ccser2 T C 14: 36,941,165 K21E probably damaging Het
Cd93 A T 2: 148,441,519 Y636N probably damaging Het
Cep128 A T 12: 91,296,224 N300K possibly damaging Het
Cfap44 A G 16: 44,449,097 T1155A probably benign Het
Clec16a T C 16: 10,630,087 L550P probably damaging Het
Csmd3 T C 15: 47,755,391 Y1867C probably damaging Het
Cul3 A T 1: 80,271,532 I674N probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp2d34 T C 15: 82,616,351 H429R probably benign Het
Dab2ip T A 2: 35,692,255 C4* probably null Het
Dcaf1 A G 9: 106,854,247 E641G probably damaging Het
Dda1 T A 8: 71,474,632 probably benign Het
Dmgdh C T 13: 93,752,452 T866I probably benign Het
Ect2l T C 10: 18,161,502 T383A probably benign Het
Ets2 A G 16: 95,714,372 N181D probably benign Het
Ezh2 A G 6: 47,552,423 F222L probably damaging Het
Frem3 T C 8: 80,615,587 L1503P probably damaging Het
Fsip2 C A 2: 82,979,433 A2032E probably damaging Het
Gm1818 C T 12: 48,555,563 noncoding transcript Het
Gm9493 A G 19: 23,619,742 S1G probably damaging Het
Grin2b A G 6: 135,733,944 I868T possibly damaging Het
Ift22 A T 5: 136,911,133 T17S possibly damaging Het
Il4ra T C 7: 125,571,563 W216R probably damaging Het
Kcnj6 A T 16: 94,832,377 W274R probably damaging Het
Kctd19 G A 8: 105,396,450 H111Y probably damaging Het
Kremen2 A G 17: 23,742,705 V276A probably benign Het
Lig1 C A 7: 13,288,672 Q143K probably damaging Het
Lrp1 A T 10: 127,567,490 D2071E probably damaging Het
Macf1 C T 4: 123,510,743 M475I probably damaging Het
Mbtd1 G A 11: 93,929,659 A427T probably damaging Het
Myof A G 19: 37,926,981 probably null Het
Nbeal2 T C 9: 110,641,877 D308G possibly damaging Het
Ncdn T C 4: 126,745,031 Q665R probably benign Het
Nkd1 T C 8: 88,589,814 probably null Het
Nktr G A 9: 121,748,389 probably benign Het
Npc1l1 A T 11: 6,217,806 M995K possibly damaging Het
Olfr1129 C A 2: 87,576,019 R312S probably benign Het
Olfr300-ps1 T A 7: 86,443,189 C69* probably null Het
Olfr740 A T 14: 50,453,744 R231* probably null Het
Padi4 T C 4: 140,760,040 T184A probably damaging Het
Pgm2l1 C T 7: 100,266,674 P409S probably benign Het
Pgpep1 G A 8: 70,652,451 T53M probably damaging Het
Pgr T C 9: 8,902,005 L513P probably damaging Het
Pikfyve T A 1: 65,272,571 I1989N probably damaging Het
Prrc2a T C 17: 35,152,740 T1806A probably benign Het
Psd T C 19: 46,323,314 E309G possibly damaging Het
Qtrt1 C T 9: 21,412,003 T50I probably damaging Het
Rims2 A C 15: 39,675,020 T1320P probably damaging Het
Scn11a T G 9: 119,765,448 N1293T probably damaging Het
Scn8a T C 15: 100,974,667 F529S possibly damaging Het
Sec14l4 A T 11: 4,035,142 D25V possibly damaging Het
Sema3a C T 5: 13,565,865 R419C probably damaging Het
Slc12a1 T C 2: 125,190,213 Y595H probably damaging Het
Slc25a28 A T 19: 43,666,925 H170Q possibly damaging Het
Slc26a1 T A 5: 108,673,765 Q86L probably damaging Het
Slc48a1 T A 15: 97,789,917 W51R probably damaging Het
Sptlc3 T A 2: 139,581,613 V309D probably damaging Het
Srcap G A 7: 127,541,356 S1375N probably damaging Het
Tanc1 C A 2: 59,817,493 H986Q possibly damaging Het
Tbc1d4 A G 14: 101,489,917 V486A probably damaging Het
Tceanc2 T C 4: 107,147,579 D124G probably damaging Het
Tdrd9 A G 12: 112,013,286 M402V possibly damaging Het
Tmem62 T A 2: 120,977,462 I55N probably damaging Het
Tnfrsf21 A T 17: 43,039,715 N257Y possibly damaging Het
Trappc3 T C 4: 126,274,041 L131P probably damaging Het
Vmn2r25 A T 6: 123,822,941 M814K possibly damaging Het
Vmn2r87 T C 10: 130,472,357 I671V probably benign Het
Vwa8 A T 14: 79,082,873 D1108V probably benign Het
Xrcc4 C G 13: 89,991,079 A241P possibly damaging Het
Xylt1 T A 7: 117,591,908 D310E probably benign Het
Zfp27 T G 7: 29,895,019 H507P possibly damaging Het
Zfp341 C T 2: 154,625,034 P108S probably benign Het
Zfp641 T C 15: 98,292,935 N76S probably benign Het
Zfp936 T C 7: 43,190,363 V418A probably benign Het
Other mutations in Tmem132d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00990:Tmem132d APN 5 127784832 missense possibly damaging 0.77
IGL01393:Tmem132d APN 5 127784638 missense probably benign 0.31
IGL01482:Tmem132d APN 5 128269206 missense probably damaging 0.96
IGL01785:Tmem132d APN 5 127984315 missense probably benign 0.00
IGL02409:Tmem132d APN 5 127784888 missense probably damaging 1.00
IGL02539:Tmem132d APN 5 127783979 missense probably benign 0.01
IGL03411:Tmem132d APN 5 127984283 nonsense probably null
R0113:Tmem132d UTSW 5 127784593 missense probably benign 0.11
R0420:Tmem132d UTSW 5 127864646 missense probably benign 0.26
R0437:Tmem132d UTSW 5 127789785 missense probably damaging 0.99
R0468:Tmem132d UTSW 5 128269203 missense probably damaging 1.00
R0564:Tmem132d UTSW 5 127784778 missense probably damaging 1.00
R0659:Tmem132d UTSW 5 127984287 missense possibly damaging 0.94
R0924:Tmem132d UTSW 5 127984439 splice site probably benign
R1209:Tmem132d UTSW 5 127784870 missense probably damaging 1.00
R1333:Tmem132d UTSW 5 127784859 missense probably benign
R1378:Tmem132d UTSW 5 128268947 missense probably benign 0.43
R1741:Tmem132d UTSW 5 127784858 missense probably benign 0.30
R1753:Tmem132d UTSW 5 127789855 missense probably benign 0.02
R1944:Tmem132d UTSW 5 127783764 makesense probably null
R1974:Tmem132d UTSW 5 128269199 missense probably damaging 0.99
R2035:Tmem132d UTSW 5 127792458 missense probably damaging 1.00
R2065:Tmem132d UTSW 5 127784441 missense probably benign
R2074:Tmem132d UTSW 5 128269131 missense probably damaging 1.00
R2276:Tmem132d UTSW 5 127795923 missense probably damaging 1.00
R2297:Tmem132d UTSW 5 128268544 missense possibly damaging 0.69
R2424:Tmem132d UTSW 5 127864599 missense probably benign 0.09
R2902:Tmem132d UTSW 5 127783768 missense probably benign
R3053:Tmem132d UTSW 5 127792474 missense probably benign 0.15
R3836:Tmem132d UTSW 5 127784885 missense probably damaging 1.00
R4127:Tmem132d UTSW 5 128268820 missense probably benign 0.35
R4236:Tmem132d UTSW 5 128432325 missense possibly damaging 0.89
R4358:Tmem132d UTSW 5 127984341 missense possibly damaging 0.92
R4610:Tmem132d UTSW 5 127984296 missense probably benign 0.29
R4686:Tmem132d UTSW 5 127792610 missense possibly damaging 0.55
R4814:Tmem132d UTSW 5 127984264 missense probably benign 0.01
R4883:Tmem132d UTSW 5 128269300 missense probably damaging 0.99
R4883:Tmem132d UTSW 5 128269302 missense possibly damaging 0.79
R4939:Tmem132d UTSW 5 127796075 missense probably damaging 1.00
R5579:Tmem132d UTSW 5 127796000 missense possibly damaging 0.67
R5652:Tmem132d UTSW 5 127784795 missense possibly damaging 0.88
R5801:Tmem132d UTSW 5 127784900 missense possibly damaging 0.50
R5900:Tmem132d UTSW 5 128269272 missense probably damaging 1.00
R5980:Tmem132d UTSW 5 127784598 missense probably benign 0.13
R6048:Tmem132d UTSW 5 128269117 missense probably benign 0.03
R6084:Tmem132d UTSW 5 127784100 missense probably benign 0.06
R6505:Tmem132d UTSW 5 127784438 missense probably benign 0.00
R6522:Tmem132d UTSW 5 127783768 missense probably benign
R6540:Tmem132d UTSW 5 128268532 missense possibly damaging 0.87
R6717:Tmem132d UTSW 5 127784421 missense probably benign
R7158:Tmem132d UTSW 5 128137019 missense possibly damaging 0.81
R7287:Tmem132d UTSW 5 127984351 missense probably damaging 0.96
R7526:Tmem132d UTSW 5 127784141 nonsense probably null
R7826:Tmem132d UTSW 5 127789889 missense probably damaging 1.00
R7864:Tmem132d UTSW 5 127783916 missense probably damaging 1.00
R8124:Tmem132d UTSW 5 127792560 missense probably damaging 1.00
R8543:Tmem132d UTSW 5 128268735 missense probably benign 0.00
R8694:Tmem132d UTSW 5 127792431 missense probably benign 0.06
R8936:Tmem132d UTSW 5 127792612 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGATGCTGGCTGTTCCCAC -3'
(R):5'- TGCTCCACATGTTGACCCAC -3'

Posted On2017-07-14