Incidental Mutation 'R4523:Dmgdh'
ID334325
Institutional Source Beutler Lab
Gene Symbol Dmgdh
Ensembl Gene ENSMUSG00000042102
Gene Namedimethylglycine dehydrogenase precursor
Synonyms
MMRRC Submission 042004-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4523 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location93674433-93752833 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 93688630 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 154 (Q154*)
Ref Sequence ENSEMBL: ENSMUSP00000039663 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048001]
Predicted Effect probably null
Transcript: ENSMUST00000048001
AA Change: Q154*
SMART Domains Protein: ENSMUSP00000039663
Gene: ENSMUSG00000042102
AA Change: Q154*

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:DAO 44 407 9.3e-64 PFAM
Pfam:FAO_M 410 464 1e-15 PFAM
Pfam:GCV_T 468 738 3.6e-72 PFAM
Pfam:SoxG 559 697 1.3e-10 PFAM
Pfam:GCV_T_C 745 838 3.9e-26 PFAM
Meta Mutation Damage Score 0.9754 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: This gene encodes an enzyme involved in the catabolism of choline, catalyzing the oxidative demethylation of dimethylglycine to form sarcosine. The enzyme is found as a monomer in the mitochondrial matrix, and uses flavin adenine dinucleotide and folate as cofactors. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp8a1 G T 5: 67,667,600 T796K probably benign Het
Atr T C 9: 95,862,863 S78P probably damaging Het
BC017643 A G 11: 121,224,108 probably benign Het
Calb2 C T 8: 110,148,509 probably null Het
Ccdc88c G T 12: 100,913,332 S1843R possibly damaging Het
Cdca7 A G 2: 72,479,698 S77G probably damaging Het
Cnot2 C T 10: 116,581,474 probably benign Het
Cstf2t T A 19: 31,083,082 V6D possibly damaging Het
Dido1 T C 2: 180,672,292 I852V probably damaging Het
Dnah12 T C 14: 26,770,022 F1138S probably damaging Het
Dnah12 G A 14: 26,876,958 A998T possibly damaging Het
Dusp5 T G 19: 53,537,601 Y225D probably damaging Het
Fam122c G A X: 53,293,499 R94H possibly damaging Het
Fam126a T C 5: 23,965,122 T410A probably benign Het
Fam193a G A 5: 34,443,371 D601N probably benign Het
Fbxo41 A G 6: 85,484,042 I228T probably damaging Het
Fmo2 T C 1: 162,887,708 K115R probably benign Het
Gak G T 5: 108,576,566 Q1093K probably benign Het
Gm5277 G T 3: 78,892,186 noncoding transcript Het
Gm7173 A T X: 79,509,995 N291K possibly damaging Het
Hgsnat A G 8: 25,968,361 probably null Het
Map3k3 G A 11: 106,148,868 R278H probably damaging Het
Mrvi1 T C 7: 110,923,841 M338V probably benign Het
Muc4 T C 16: 32,736,336 probably benign Het
Nectin3 C A 16: 46,448,590 R483L probably benign Het
Nop2 G T 6: 125,133,552 R47L probably damaging Het
Ntng1 A G 3: 109,934,996 S154P probably damaging Het
Olfml2b T C 1: 170,669,222 I474T probably benign Het
Olfr1054 C G 2: 86,333,300 D19H probably benign Het
Olfr843 T C 9: 19,249,229 T57A probably damaging Het
Optc G T 1: 133,903,754 T138K possibly damaging Het
Orc4 G A 2: 48,937,489 P31S probably benign Het
Pard3 C T 8: 127,398,627 P421S probably benign Het
Pcdhb22 G T 18: 37,520,421 E647D probably benign Het
Pclo A G 5: 14,679,992 probably benign Het
Prkce G T 17: 86,490,750 probably null Het
Prr12 T C 7: 45,048,523 D656G unknown Het
Ptprk A T 10: 28,466,052 D485V probably damaging Het
Ptprn2 T C 12: 116,876,000 L381P probably damaging Het
Rnf144b T C 13: 47,207,537 I51T probably benign Het
Rpl10l T C 12: 66,283,738 D207G probably benign Het
Sh3glb2 A T 2: 30,350,699 V118E probably damaging Het
Sipa1l2 C T 8: 125,492,424 G58D probably damaging Het
Slc5a4a C T 10: 76,148,362 A46V probably damaging Het
Tepp T A 8: 95,313,010 Y18* probably null Het
Tgm7 C A 2: 121,098,588 probably null Het
Tjap1 A G 17: 46,258,792 V424A probably benign Het
Trpm6 A T 19: 18,796,500 I414F probably damaging Het
Tsr3 C G 17: 25,241,749 D196E probably benign Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Vmn2r72 T A 7: 85,751,926 H95L probably benign Het
Vmn2r97 T A 17: 18,929,071 N240K probably benign Het
Xdh C A 17: 73,898,344 G1042V probably damaging Het
Zcchc4 A G 5: 52,784,067 D68G probably damaging Het
Other mutations in Dmgdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01080:Dmgdh APN 13 93703778 splice site probably benign
IGL01406:Dmgdh APN 13 93687031 splice site probably benign
IGL01408:Dmgdh APN 13 93709295 missense probably damaging 1.00
IGL02167:Dmgdh APN 13 93720627 splice site probably benign
IGL02538:Dmgdh APN 13 93708753 missense possibly damaging 0.50
IGL02550:Dmgdh APN 13 93717575 missense probably damaging 1.00
IGL02563:Dmgdh APN 13 93674539 splice site probably benign
IGL02668:Dmgdh APN 13 93703910 missense probably damaging 1.00
IGL02889:Dmgdh APN 13 93715677 critical splice donor site probably null
IGL03293:Dmgdh APN 13 93706701 missense probably benign 0.11
R0646:Dmgdh UTSW 13 93752355 missense probably benign 0.04
R1531:Dmgdh UTSW 13 93744411 missense probably damaging 1.00
R1746:Dmgdh UTSW 13 93752425 missense probably benign
R1795:Dmgdh UTSW 13 93706699 missense probably benign
R1943:Dmgdh UTSW 13 93711370 missense probably benign 0.08
R1959:Dmgdh UTSW 13 93720559 missense probably benign 0.01
R3421:Dmgdh UTSW 13 93711361 missense probably benign 0.01
R3727:Dmgdh UTSW 13 93692067 missense probably damaging 1.00
R5000:Dmgdh UTSW 13 93688538 missense probably damaging 1.00
R5589:Dmgdh UTSW 13 93677157 missense probably damaging 1.00
R5913:Dmgdh UTSW 13 93752323 missense possibly damaging 0.92
R6056:Dmgdh UTSW 13 93708743 missense possibly damaging 0.67
R6056:Dmgdh UTSW 13 93752326 missense probably damaging 1.00
R6057:Dmgdh UTSW 13 93752452 missense probably benign 0.00
R6180:Dmgdh UTSW 13 93752286 missense possibly damaging 0.61
R6259:Dmgdh UTSW 13 93752308 missense probably benign 0.01
R6608:Dmgdh UTSW 13 93706744 missense possibly damaging 0.81
R6636:Dmgdh UTSW 13 93709198 missense probably benign 0.08
R6637:Dmgdh UTSW 13 93709198 missense probably benign 0.08
R6739:Dmgdh UTSW 13 93720615 missense probably benign 0.07
R7157:Dmgdh UTSW 13 93715535 missense probably damaging 1.00
R7200:Dmgdh UTSW 13 93691885 missense probably damaging 1.00
R7312:Dmgdh UTSW 13 93708846 splice site probably null
R7349:Dmgdh UTSW 13 93752233 missense possibly damaging 0.80
X0066:Dmgdh UTSW 13 93752374 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- CACTGTGCTAGGGAACTGTTTGAG -3'
(R):5'- TAACGGCCTACACTGTGACC -3'

Sequencing Primer
(F):5'- AACTGTTTGAGTGCCTGAAGAC -3'
(R):5'- GTGTAACACCTACCGTCTAATGTTGG -3'
Posted On2015-08-18