Mutagenetix > Incidental Mutation

Incidental Mutation 'R6057:Pikfyve'

482938

Institutional Source

Beutler Lab

Gene Symbol

Pikfyve

Ensembl Gene

ENSMUSG00000025949

Gene Name

phosphoinositide kinase, FYVE type zinc finger containing

Synonyms

Pip5k3

Accession Numbers

Genbank: NM_011086

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6057 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

65186683-65278695 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 65272571 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 1989 (I1989N)

Ref Sequence

ENSEMBL: ENSMUSP00000095314 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000097707]

AlphaFold

Q9Z1T6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000081154
AA Change: I1944N

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949
AA Change: I1944N

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC
FYVE	161	230	5.95e-18	SMART
DEP	376	451	9.05e-27	SMART
Pfam:Cpn60_TCP1	547	822	2e-37	PFAM
low complexity region	1177	1189	N/A	INTRINSIC
low complexity region	1516	1536	N/A	INTRINSIC
PIPKc	1745	2039	3.03e-162	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000097707
AA Change: I1989N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000095314
Gene: ENSMUSG00000025949
AA Change: I1989N

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC
FYVE	150	219	5.95e-18	SMART
DEP	365	440	9.05e-27	SMART
Pfam:Cpn60_TCP1	590	864	1.8e-35	PFAM
low complexity region	1222	1234	N/A	INTRINSIC
low complexity region	1561	1581	N/A	INTRINSIC
PIPKc	1790	2084	3.03e-162	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]

Allele List at MGI

All alleles(16) : Gene trapped(16)

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
5730596B20Rik	A	G	6: 52,179,520		probably benign	Het
Acan	A	G	7: 79,099,782	S11G	probably null	Het
Ankrd13d	A	C	19: 4,282,228	V56G	probably damaging	Het
Arl15	A	G	13: 113,967,615	Y76C	probably damaging	Het
Aspg	G	A	12: 112,120,998	C296Y	probably damaging	Het
Astl	T	A	2: 127,345,969	D101E	probably benign	Het
Bmpr2	A	G	1: 59,842,818	N202S	probably benign	Het
Borcs7	T	C	19: 46,701,564	*106Q	probably null	Het
Brip1	A	G	11: 86,065,039	S883P	possibly damaging	Het
Cacng2	A	T	15: 78,118,791	L34Q	probably damaging	Het
Catip	A	C	1: 74,362,918	D84A	probably damaging	Het
Ccdc162	A	G	10: 41,634,041	L856S	possibly damaging	Het
Ccdc38	A	G	10: 93,581,746	K500E	probably damaging	Het
Ccser2	T	C	14: 36,941,165	K21E	probably damaging	Het
Cd93	A	T	2: 148,441,519	Y636N	probably damaging	Het
Cep128	A	T	12: 91,296,224	N300K	possibly damaging	Het
Cfap44	A	G	16: 44,449,097	T1155A	probably benign	Het
Clec16a	T	C	16: 10,630,087	L550P	probably damaging	Het
Csmd3	T	C	15: 47,755,391	Y1867C	probably damaging	Het
Cul3	A	T	1: 80,271,532	I674N	probably damaging	Het
Cybb	C	G	X: 9,450,750	D246H	probably benign	Het
Cyp2d34	T	C	15: 82,616,351	H429R	probably benign	Het
Dab2ip	T	A	2: 35,692,255	C4*	probably null	Het
Dcaf1	A	G	9: 106,854,247	E641G	probably damaging	Het
Dda1	T	A	8: 71,474,632		probably benign	Het
Dmgdh	C	T	13: 93,752,452	T866I	probably benign	Het
Ect2l	T	C	10: 18,161,502	T383A	probably benign	Het
Ets2	A	G	16: 95,714,372	N181D	probably benign	Het
Ezh2	A	G	6: 47,552,423	F222L	probably damaging	Het
Frem3	T	C	8: 80,615,587	L1503P	probably damaging	Het
Fsip2	C	A	2: 82,979,433	A2032E	probably damaging	Het
Gm1818	C	T	12: 48,555,563		noncoding transcript	Het
Gm9493	A	G	19: 23,619,742	S1G	probably damaging	Het
Grin2b	A	G	6: 135,733,944	I868T	possibly damaging	Het
Ift22	A	T	5: 136,911,133	T17S	possibly damaging	Het
Il4ra	T	C	7: 125,571,563	W216R	probably damaging	Het
Kcnj6	A	T	16: 94,832,377	W274R	probably damaging	Het
Kctd19	G	A	8: 105,396,450	H111Y	probably damaging	Het
Kremen2	A	G	17: 23,742,705	V276A	probably benign	Het
Lig1	C	A	7: 13,288,672	Q143K	probably damaging	Het
Lrp1	A	T	10: 127,567,490	D2071E	probably damaging	Het
Macf1	C	T	4: 123,510,743	M475I	probably damaging	Het
Mbtd1	G	A	11: 93,929,659	A427T	probably damaging	Het
Myof	A	G	19: 37,926,981		probably null	Het
Nbeal2	T	C	9: 110,641,877	D308G	possibly damaging	Het
Ncdn	T	C	4: 126,745,031	Q665R	probably benign	Het
Nkd1	T	C	8: 88,589,814		probably null	Het
Nktr	G	A	9: 121,748,389		probably benign	Het
Npc1l1	A	T	11: 6,217,806	M995K	possibly damaging	Het
Olfr1129	C	A	2: 87,576,019	R312S	probably benign	Het
Olfr300-ps1	T	A	7: 86,443,189	C69*	probably null	Het
Olfr740	A	T	14: 50,453,744	R231*	probably null	Het
Padi4	T	C	4: 140,760,040	T184A	probably damaging	Het
Pgm2l1	C	T	7: 100,266,674	P409S	probably benign	Het
Pgpep1	G	A	8: 70,652,451	T53M	probably damaging	Het
Pgr	T	C	9: 8,902,005	L513P	probably damaging	Het
Prrc2a	T	C	17: 35,152,740	T1806A	probably benign	Het
Psd	T	C	19: 46,323,314	E309G	possibly damaging	Het
Qtrt1	C	T	9: 21,412,003	T50I	probably damaging	Het
Rims2	A	C	15: 39,675,020	T1320P	probably damaging	Het
Scn11a	T	G	9: 119,765,448	N1293T	probably damaging	Het
Scn8a	T	C	15: 100,974,667	F529S	possibly damaging	Het
Sec14l4	A	T	11: 4,035,142	D25V	possibly damaging	Het
Sema3a	C	T	5: 13,565,865	R419C	probably damaging	Het
Slc12a1	T	C	2: 125,190,213	Y595H	probably damaging	Het
Slc25a28	A	T	19: 43,666,925	H170Q	possibly damaging	Het
Slc26a1	T	A	5: 108,673,765	Q86L	probably damaging	Het
Slc48a1	T	A	15: 97,789,917	W51R	probably damaging	Het
Sptlc3	T	A	2: 139,581,613	V309D	probably damaging	Het
Srcap	G	A	7: 127,541,356	S1375N	probably damaging	Het
Tanc1	C	A	2: 59,817,493	H986Q	possibly damaging	Het
Tbc1d4	A	G	14: 101,489,917	V486A	probably damaging	Het
Tceanc2	T	C	4: 107,147,579	D124G	probably damaging	Het
Tdrd9	A	G	12: 112,013,286	M402V	possibly damaging	Het
Tmem132d	T	C	5: 127,784,870	D729G	probably damaging	Het
Tmem62	T	A	2: 120,977,462	I55N	probably damaging	Het
Tnfrsf21	A	T	17: 43,039,715	N257Y	possibly damaging	Het
Trappc3	T	C	4: 126,274,041	L131P	probably damaging	Het
Vmn2r25	A	T	6: 123,822,941	M814K	possibly damaging	Het
Vmn2r87	T	C	10: 130,472,357	I671V	probably benign	Het
Vwa8	A	T	14: 79,082,873	D1108V	probably benign	Het
Xrcc4	C	G	13: 89,991,079	A241P	possibly damaging	Het
Xylt1	T	A	7: 117,591,908	D310E	probably benign	Het
Zfp27	T	G	7: 29,895,019	H507P	possibly damaging	Het
Zfp341	C	T	2: 154,625,034	P108S	probably benign	Het
Zfp641	T	C	15: 98,292,935	N76S	probably benign	Het
Zfp936	T	C	7: 43,190,363	V418A	probably benign	Het

Other mutations in Pikfyve

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Pikfyve	APN	1	65260121	critical splice donor site	probably null
IGL01135:Pikfyve	APN	1	65251635	missense	probably damaging	0.96
IGL01511:Pikfyve	APN	1	65258869	nonsense	probably null
IGL01759:Pikfyve	APN	1	65253353	missense	probably benign	0.06
IGL01888:Pikfyve	APN	1	65223640	missense	probably damaging	1.00
IGL01967:Pikfyve	APN	1	65264365	missense	possibly damaging	0.89
IGL02055:Pikfyve	APN	1	65238544	critical splice donor site	probably null
IGL02119:Pikfyve	APN	1	65272571	missense	probably damaging	1.00
IGL02141:Pikfyve	APN	1	65246397	missense	probably benign	0.13
IGL02207:Pikfyve	APN	1	65251678	critical splice donor site	probably null
IGL02380:Pikfyve	APN	1	65256021	missense	probably damaging	0.99
IGL02400:Pikfyve	APN	1	65252569	missense	probably damaging	1.00
IGL02403:Pikfyve	APN	1	65244504	missense	probably damaging	0.99
IGL02426:Pikfyve	APN	1	65251612	missense	possibly damaging	0.77
IGL02496:Pikfyve	APN	1	65264376	missense	possibly damaging	0.94
IGL02573:Pikfyve	APN	1	65230855	critical splice donor site	probably null
IGL02746:Pikfyve	APN	1	65234272	missense	probably damaging	1.00
IGL02814:Pikfyve	APN	1	65250194	nonsense	probably null
IGL02890:Pikfyve	APN	1	65230797	missense	probably benign	0.00
IGL03102:Pikfyve	APN	1	65252467	nonsense	probably null
IGL03294:Pikfyve	APN	1	65247067	missense	probably damaging	1.00
falcon	UTSW	1	65196741	missense	probably damaging	1.00
oompa	UTSW	1	65196706	missense	probably damaging	1.00
wonka	UTSW	1	65196706	missense	probably damaging	1.00
G5538:Pikfyve	UTSW	1	65202916	missense	probably damaging	1.00
R0031:Pikfyve	UTSW	1	65215929	splice site	probably benign
R0196:Pikfyve	UTSW	1	65256072	missense	possibly damaging	0.92
R0212:Pikfyve	UTSW	1	65262905	missense	probably benign	0.41
R0319:Pikfyve	UTSW	1	65246331	missense	probably benign	0.01
R0332:Pikfyve	UTSW	1	65264399	missense	probably benign	0.02
R0389:Pikfyve	UTSW	1	65196706	missense	probably damaging	1.00
R0443:Pikfyve	UTSW	1	65196706	missense	probably damaging	1.00
R0503:Pikfyve	UTSW	1	65219899	missense	probably damaging	0.97
R0722:Pikfyve	UTSW	1	65253523	missense	probably damaging	0.99
R0906:Pikfyve	UTSW	1	65253397	missense	probably damaging	1.00
R0907:Pikfyve	UTSW	1	65202830	missense	possibly damaging	0.64
R0970:Pikfyve	UTSW	1	65265824	missense	probably damaging	0.99
R1188:Pikfyve	UTSW	1	65246959	missense	possibly damaging	0.46
R1412:Pikfyve	UTSW	1	65202830	missense	possibly damaging	0.64
R1421:Pikfyve	UTSW	1	65271311	missense	probably damaging	1.00
R1468:Pikfyve	UTSW	1	65251666	missense	probably damaging	0.98
R1468:Pikfyve	UTSW	1	65251666	missense	probably damaging	0.98
R1472:Pikfyve	UTSW	1	65224201	missense	probably damaging	0.96
R1478:Pikfyve	UTSW	1	65262977	critical splice donor site	probably null
R1501:Pikfyve	UTSW	1	65265284	missense	possibly damaging	0.84
R1757:Pikfyve	UTSW	1	65252548	missense	probably damaging	0.99
R1773:Pikfyve	UTSW	1	65192271	missense	probably damaging	0.99
R1773:Pikfyve	UTSW	1	65246370	missense	probably benign
R1795:Pikfyve	UTSW	1	65252557	missense	probably damaging	1.00
R1855:Pikfyve	UTSW	1	65258798	missense	probably benign	0.03
R1905:Pikfyve	UTSW	1	65192295	critical splice donor site	probably null
R1995:Pikfyve	UTSW	1	65246708	missense	probably damaging	1.00
R2034:Pikfyve	UTSW	1	65222357	missense	probably damaging	1.00
R2045:Pikfyve	UTSW	1	65253353	missense	probably benign	0.06
R2229:Pikfyve	UTSW	1	65267855	missense	probably damaging	1.00
R2295:Pikfyve	UTSW	1	65246676	missense	probably damaging	0.99
R2913:Pikfyve	UTSW	1	65253517	missense	probably damaging	1.00
R3818:Pikfyve	UTSW	1	65245758	missense	probably damaging	1.00
R3832:Pikfyve	UTSW	1	65244420	missense	probably damaging	0.99
R3850:Pikfyve	UTSW	1	65230845	missense	probably damaging	1.00
R3946:Pikfyve	UTSW	1	65196681	missense	probably damaging	1.00
R4105:Pikfyve	UTSW	1	65190520	unclassified	probably benign
R4542:Pikfyve	UTSW	1	65244430	missense	probably damaging	1.00
R4574:Pikfyve	UTSW	1	65192192	missense	probably damaging	1.00
R4601:Pikfyve	UTSW	1	65234262	missense	probably damaging	1.00
R4667:Pikfyve	UTSW	1	65250273	missense	probably damaging	1.00
R4668:Pikfyve	UTSW	1	65250273	missense	probably damaging	1.00
R4669:Pikfyve	UTSW	1	65250273	missense	probably damaging	1.00
R4707:Pikfyve	UTSW	1	65267846	missense	probably benign
R4716:Pikfyve	UTSW	1	65246476	missense	possibly damaging	0.84
R4758:Pikfyve	UTSW	1	65272515	missense	possibly damaging	0.84
R4784:Pikfyve	UTSW	1	65267846	missense	probably benign
R4785:Pikfyve	UTSW	1	65267846	missense	probably benign
R4805:Pikfyve	UTSW	1	65268800	missense	probably damaging	0.99
R4831:Pikfyve	UTSW	1	65196741	missense	probably damaging	1.00
R4837:Pikfyve	UTSW	1	65246590	missense	possibly damaging	0.92
R5064:Pikfyve	UTSW	1	65253407	missense	probably damaging	1.00
R5115:Pikfyve	UTSW	1	65224117	intron	probably benign
R5265:Pikfyve	UTSW	1	65267829	missense	possibly damaging	0.72
R5279:Pikfyve	UTSW	1	65196699	nonsense	probably null
R5384:Pikfyve	UTSW	1	65244409	missense	probably damaging	1.00
R5387:Pikfyve	UTSW	1	65265268	missense	possibly damaging	0.94
R5461:Pikfyve	UTSW	1	65235033	missense	probably damaging	1.00
R5467:Pikfyve	UTSW	1	65252495	missense	probably damaging	1.00
R5560:Pikfyve	UTSW	1	65253407	missense	probably damaging	1.00
R5575:Pikfyve	UTSW	1	65273730	missense	probably damaging	1.00
R5611:Pikfyve	UTSW	1	65256088	missense	probably damaging	0.96
R5663:Pikfyve	UTSW	1	65216028	missense	probably benign	0.09
R5891:Pikfyve	UTSW	1	65202737	missense	probably damaging	1.00
R5960:Pikfyve	UTSW	1	65253438	nonsense	probably null
R6026:Pikfyve	UTSW	1	65272697	missense	probably damaging	1.00
R6101:Pikfyve	UTSW	1	65264345	critical splice acceptor site	probably null
R6105:Pikfyve	UTSW	1	65264345	critical splice acceptor site	probably null
R6161:Pikfyve	UTSW	1	65216043	missense	probably benign	0.36
R6287:Pikfyve	UTSW	1	65253532	critical splice donor site	probably null
R6290:Pikfyve	UTSW	1	65202925	critical splice donor site	probably null
R6296:Pikfyve	UTSW	1	65262953	missense	probably damaging	0.99
R6516:Pikfyve	UTSW	1	65265781	missense	probably benign	0.35
R6835:Pikfyve	UTSW	1	65258843	missense	probably damaging	0.98
R6994:Pikfyve	UTSW	1	65252530	missense	probably damaging	1.00
R6997:Pikfyve	UTSW	1	65246663	missense	probably damaging	1.00
R7038:Pikfyve	UTSW	1	65234361	missense	probably damaging	1.00
R7044:Pikfyve	UTSW	1	65246854	missense	probably benign	0.01
R7057:Pikfyve	UTSW	1	65247205	missense	probably benign	0.00
R7525:Pikfyve	UTSW	1	65244426	nonsense	probably null
R7558:Pikfyve	UTSW	1	65272623	missense	probably benign	0.01
R7625:Pikfyve	UTSW	1	65267877	missense	possibly damaging	0.86
R7807:Pikfyve	UTSW	1	65269942	missense	probably damaging	1.00
R7961:Pikfyve	UTSW	1	65255134	missense	probably damaging	1.00
R8009:Pikfyve	UTSW	1	65255134	missense	probably damaging	1.00
R8154:Pikfyve	UTSW	1	65265789	missense	probably damaging	1.00
R8192:Pikfyve	UTSW	1	65246395	missense	possibly damaging	0.93
R8275:Pikfyve	UTSW	1	65253342	splice site	probably benign
R8307:Pikfyve	UTSW	1	65245735	missense	possibly damaging	0.77
R8710:Pikfyve	UTSW	1	65215996	missense	possibly damaging	0.94
R8867:Pikfyve	UTSW	1	65244417	missense	probably damaging	1.00
R8936:Pikfyve	UTSW	1	65271268	missense	possibly damaging	0.84
R8940:Pikfyve	UTSW	1	65246970	missense	probably benign	0.00
R8995:Pikfyve	UTSW	1	65205587	critical splice acceptor site	probably null
R9092:Pikfyve	UTSW	1	65244400	missense	probably damaging	1.00
R9131:Pikfyve	UTSW	1	65246080	missense	probably damaging	1.00
R9151:Pikfyve	UTSW	1	65196739	missense	probably damaging	1.00
R9210:Pikfyve	UTSW	1	65252560	missense	probably damaging	1.00
R9212:Pikfyve	UTSW	1	65252560	missense	probably damaging	1.00
R9235:Pikfyve	UTSW	1	65260029	missense	probably benign	0.37
R9368:Pikfyve	UTSW	1	65268742	missense	probably damaging	1.00
R9489:Pikfyve	UTSW	1	65264402	missense	probably benign
R9605:Pikfyve	UTSW	1	65264402	missense	probably benign
R9686:Pikfyve	UTSW	1	65252456	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTGGCAGTAACTACAAGGGATC -3'
(R):5'- CCTCTGAGATTCTGCTCCAG -3'

Posted On

2017-07-14