Incidental Mutation 'R7304:Crybg1'
ID567176
Institutional Source Beutler Lab
Gene Symbol Crybg1
Ensembl Gene ENSMUSG00000019866
Gene Namecrystallin beta-gamma domain containing 1
SynonymsAim1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7304 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location43950636-44148853 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 43997258 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 1285 (D1285N)
Ref Sequence ENSEMBL: ENSMUSP00000143429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020017] [ENSMUST00000200401]
Predicted Effect probably benign
Transcript: ENSMUST00000020017
AA Change: D911N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000020017
Gene: ENSMUSG00000019866
AA Change: D911N

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
low complexity region 114 121 N/A INTRINSIC
low complexity region 176 192 N/A INTRINSIC
low complexity region 436 453 N/A INTRINSIC
low complexity region 507 518 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 837 857 N/A INTRINSIC
XTALbg 995 1078 8.57e-9 SMART
XTALbg 1094 1175 4.73e-20 SMART
XTALbg 1189 1282 1.23e-32 SMART
XTALbg 1290 1373 9.3e-28 SMART
XTALbg 1386 1465 1.66e-24 SMART
XTALbg 1473 1553 5.29e-32 SMART
RICIN 1556 1689 5.86e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200401
AA Change: D1285N

PolyPhen 2 Score 0.048 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000143429
Gene: ENSMUSG00000019866
AA Change: D1285N

DomainStartEndE-ValueType
low complexity region 377 390 N/A INTRINSIC
low complexity region 488 495 N/A INTRINSIC
low complexity region 550 566 N/A INTRINSIC
low complexity region 810 827 N/A INTRINSIC
low complexity region 881 892 N/A INTRINSIC
low complexity region 918 931 N/A INTRINSIC
low complexity region 1211 1231 N/A INTRINSIC
XTALbg 1369 1452 5.4e-11 SMART
XTALbg 1468 1549 2.9e-22 SMART
XTALbg 1563 1656 7.9e-35 SMART
XTALbg 1664 1747 6e-30 SMART
XTALbg 1760 1839 1.1e-26 SMART
XTALbg 1847 1927 3.3e-34 SMART
RICIN 1930 2063 3.3e-17 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110008L16Rik A G 12: 55,304,644 D246G probably damaging Het
Abca13 A G 11: 9,297,203 S2317G probably benign Het
Acap2 A C 16: 31,108,116 L502R probably benign Het
Amotl2 A G 9: 102,728,350 E467G probably damaging Het
Apbb1ip A T 2: 22,853,135 probably null Het
Armc9 C G 1: 86,162,715 D77E probably benign Het
Art1 T A 7: 102,106,324 S8T possibly damaging Het
Asic5 G A 3: 82,009,565 A321T possibly damaging Het
Astn2 A G 4: 66,185,375 I267T unknown Het
Bmp8a T C 4: 123,342,389 N107S probably benign Het
Card14 T A 11: 119,337,747 L633Q probably damaging Het
Chpf C T 1: 75,479,054 V18M possibly damaging Het
Cog7 T C 7: 121,937,139 I493V probably benign Het
Col3a1 A T 1: 45,347,811 N1394I unknown Het
Depdc7 A G 2: 104,723,118 V395A possibly damaging Het
Dido1 G A 2: 180,687,493 L379F probably damaging Het
Dnajc13 G T 9: 104,238,514 T32N probably benign Het
Dok2 T A 14: 70,776,028 S133R probably benign Het
Ehbp1l1 C T 19: 5,716,382 R1311H probably damaging Het
Gm15922 T C 7: 3,737,494 T243A probably damaging Het
Gm3099 A T 14: 4,000,520 N118I probably damaging Het
Gtse1 A G 15: 85,871,547 T471A probably benign Het
Heg1 G A 16: 33,760,790 A13T possibly damaging Het
Ifi209 A T 1: 173,642,590 Y248F possibly damaging Het
Itgb3bp C G 4: 99,769,521 E169Q probably damaging Het
Kcna2 A G 3: 107,104,750 T216A probably benign Het
Kcnj6 A T 16: 94,941,183 M10K probably benign Het
Krt17 T G 11: 100,257,337 Q397P probably benign Het
Lrtm1 T A 14: 29,022,118 M181K probably damaging Het
Map3k5 A G 10: 20,099,555 H741R probably damaging Het
Mier1 T A 4: 103,139,402 Y120* probably null Het
Mrvi1 T C 7: 110,899,724 T367A possibly damaging Het
Myh14 T A 7: 44,629,991 T922S probably benign Het
Nfkbie A T 17: 45,560,141 I240F possibly damaging Het
Npas3 C A 12: 54,069,041 H915Q probably damaging Het
Nrg2 A T 18: 36,045,941 V314E probably benign Het
Olfr373 T A 8: 72,100,346 Y195* probably null Het
Pds5a T C 5: 65,619,734 N28S probably damaging Het
Pkhd1l1 A T 15: 44,498,482 N517I possibly damaging Het
Plekhb1 T C 7: 100,645,667 Y99C probably benign Het
Plpp6 T C 19: 28,964,217 S73P probably benign Het
Polb T C 8: 22,639,959 N199S probably benign Het
Ppp1r13b T C 12: 111,872,406 N13D possibly damaging Het
Ptprn2 T A 12: 117,248,544 V862D probably damaging Het
Rassf4 T C 6: 116,640,317 I242M probably damaging Het
Rnf19a G A 15: 36,254,452 T320I probably damaging Het
Sctr A T 1: 120,022,240 E53V probably damaging Het
Srcin1 T C 11: 97,551,693 D103G probably benign Het
St3gal3 T C 4: 117,957,436 Q220R Het
Stk40 G A 4: 126,125,690 E86K probably benign Het
Tas2r104 T A 6: 131,685,042 I235F possibly damaging Het
Terf2ip T C 8: 112,011,648 V56A possibly damaging Het
Thsd7b A G 1: 130,103,153 N1075S probably benign Het
Trak1 A G 9: 121,416,212 Y51C probably benign Het
Trav16n T A 14: 53,351,402 V45E probably benign Het
Ttc6 T C 12: 57,576,051 S79P probably damaging Het
Unc79 C T 12: 103,063,190 T484M probably damaging Het
Usp49 T C 17: 47,672,871 V267A possibly damaging Het
Vldlr T A 19: 27,238,604 D305E possibly damaging Het
Vmn1r226 G T 17: 20,687,749 C81F probably damaging Het
Vmn1r73 T C 7: 11,756,897 V214A probably damaging Het
Vmn2r5 T C 3: 64,504,250 N299S probably damaging Het
Vwa3b T C 1: 37,164,505 L55S probably damaging Het
Wdr90 T C 17: 25,851,506 D1105G probably benign Het
Zbtb38 A G 9: 96,687,427 S535P probably damaging Het
Zfp329 T C 7: 12,810,899 I233V probably damaging Het
Zfp579 T A 7: 4,994,583 T110S probably benign Het
Other mutations in Crybg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Crybg1 APN 10 43992509 missense probably damaging 1.00
IGL00502:Crybg1 APN 10 43958313 missense probably damaging 1.00
IGL00848:Crybg1 APN 10 43967818 splice site probably null
IGL01287:Crybg1 APN 10 43992494 missense possibly damaging 0.53
IGL01310:Crybg1 APN 10 43975058 missense possibly damaging 0.95
IGL01310:Crybg1 APN 10 44003600 missense probably damaging 0.99
IGL02683:Crybg1 APN 10 43989216 missense possibly damaging 0.64
IGL03095:Crybg1 APN 10 43989249 missense probably damaging 1.00
R0062:Crybg1 UTSW 10 43997906 missense probably damaging 0.98
R0142:Crybg1 UTSW 10 43999063 missense possibly damaging 0.83
R0294:Crybg1 UTSW 10 43986376 missense probably damaging 1.00
R0539:Crybg1 UTSW 10 43998898 missense probably benign 0.03
R0781:Crybg1 UTSW 10 43999093 missense possibly damaging 0.95
R1110:Crybg1 UTSW 10 43999093 missense possibly damaging 0.95
R1189:Crybg1 UTSW 10 43998794 missense probably damaging 1.00
R1428:Crybg1 UTSW 10 43975078 missense probably benign 0.33
R1521:Crybg1 UTSW 10 43998416 missense probably damaging 1.00
R1688:Crybg1 UTSW 10 43973798 missense probably damaging 1.00
R1728:Crybg1 UTSW 10 44004019 missense probably damaging 0.97
R1756:Crybg1 UTSW 10 43986279 missense probably damaging 1.00
R1773:Crybg1 UTSW 10 43992548 missense possibly damaging 0.91
R1784:Crybg1 UTSW 10 44004019 missense probably damaging 0.97
R1850:Crybg1 UTSW 10 43997674 missense probably damaging 1.00
R1911:Crybg1 UTSW 10 43997677 missense possibly damaging 0.47
R1920:Crybg1 UTSW 10 43997548 missense probably damaging 1.00
R1964:Crybg1 UTSW 10 43958330 missense probably damaging 1.00
R2298:Crybg1 UTSW 10 43999222 missense probably damaging 1.00
R3617:Crybg1 UTSW 10 43956786 missense possibly damaging 0.82
R3913:Crybg1 UTSW 10 43998763 missense possibly damaging 0.95
R4081:Crybg1 UTSW 10 43975039 missense probably damaging 1.00
R4116:Crybg1 UTSW 10 43999162 missense possibly damaging 0.91
R4409:Crybg1 UTSW 10 43998758 missense possibly damaging 0.94
R4583:Crybg1 UTSW 10 43997620 missense probably damaging 1.00
R4721:Crybg1 UTSW 10 43997887 missense probably damaging 1.00
R4818:Crybg1 UTSW 10 43998587 missense probably benign 0.00
R4859:Crybg1 UTSW 10 43992569 missense probably damaging 1.00
R4933:Crybg1 UTSW 10 43999213 missense probably damaging 1.00
R5028:Crybg1 UTSW 10 43998212 missense possibly damaging 0.74
R5057:Crybg1 UTSW 10 43989108 nonsense probably null
R5102:Crybg1 UTSW 10 43997836 missense probably damaging 1.00
R5103:Crybg1 UTSW 10 43997948 missense probably damaging 1.00
R5137:Crybg1 UTSW 10 43958336 missense probably damaging 1.00
R5212:Crybg1 UTSW 10 43967743 missense possibly damaging 0.95
R5307:Crybg1 UTSW 10 44003714 missense probably benign 0.00
R5353:Crybg1 UTSW 10 43973665 missense probably damaging 1.00
R5463:Crybg1 UTSW 10 44003693 nonsense probably null
R5503:Crybg1 UTSW 10 43998766 missense probably benign 0.00
R5583:Crybg1 UTSW 10 44003510 missense probably benign 0.01
R5835:Crybg1 UTSW 10 43975133 missense probably benign 0.28
R6021:Crybg1 UTSW 10 43997538 missense probably damaging 1.00
R6032:Crybg1 UTSW 10 43956760 missense probably damaging 1.00
R6032:Crybg1 UTSW 10 43956760 missense probably damaging 1.00
R6277:Crybg1 UTSW 10 43997259 missense probably benign 0.03
R6338:Crybg1 UTSW 10 43992509 missense probably damaging 1.00
R6348:Crybg1 UTSW 10 44003951 missense probably damaging 1.00
R6514:Crybg1 UTSW 10 43997215 missense probably damaging 1.00
R6785:Crybg1 UTSW 10 43999171 missense probably benign 0.00
R6804:Crybg1 UTSW 10 43966341 missense probably damaging 1.00
R6938:Crybg1 UTSW 10 43997383 missense probably benign 0.01
R6983:Crybg1 UTSW 10 43999342 missense probably damaging 1.00
R7002:Crybg1 UTSW 10 43998835 missense probably damaging 1.00
R7153:Crybg1 UTSW 10 43964666 missense possibly damaging 0.64
R7271:Crybg1 UTSW 10 43997623 nonsense probably null
R7293:Crybg1 UTSW 10 44003432 missense probably damaging 1.00
R7313:Crybg1 UTSW 10 43989111 missense probably damaging 0.98
R7373:Crybg1 UTSW 10 44004140 missense probably benign 0.00
R7449:Crybg1 UTSW 10 44004519 missense probably benign
R7530:Crybg1 UTSW 10 43999073 missense possibly damaging 0.62
R7660:Crybg1 UTSW 10 43998835 missense probably damaging 0.97
R7701:Crybg1 UTSW 10 43989143 missense probably benign 0.06
R8359:Crybg1 UTSW 10 43992542 missense probably benign 0.03
RF005:Crybg1 UTSW 10 44004745 missense probably benign 0.03
RF024:Crybg1 UTSW 10 44004745 missense probably benign 0.03
X0065:Crybg1 UTSW 10 43992526 synonymous silent
Z1088:Crybg1 UTSW 10 43997311 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCATAGAGTCTGATAAGGACATTCC -3'
(R):5'- TCAGAACAGCTCCGTATCTCAG -3'

Sequencing Primer
(F):5'- TCTGATAAGGACATTCCAGAAAAGG -3'
(R):5'- CGTATCTCAGTCATCAGTGGTACAG -3'
Posted On2019-06-26