Mutagenetix > Incidental Mutation

Incidental Mutation 'R6283:Bhlhe40'

508043

Institutional Source

Beutler Lab

Gene Symbol

Bhlhe40

Ensembl Gene

ENSMUSG00000030103

Gene Name

basic helix-loop-helix family, member e40

Synonyms

Stra13, C130042M06Rik, eip1 (E47 interaction protein 1), Sharp2, Stra14, DEC1, Bhlhb2, cytokine response gene 8, CR8, Clast5

MMRRC Submission

044453-MU

Accession Numbers

Genbank: NM_011498; MGI: 1097714

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6283 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

108660629-108666925 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 108665031 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 312 (L312P)

Ref Sequence

ENSEMBL: ENSMUSP00000032194 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032194] [ENSMUST00000163617]

AlphaFold

O35185

Predicted Effect

probably damaging
Transcript: ENSMUST00000032194
AA Change: L312P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000032194
Gene: ENSMUSG00000030103
AA Change: L312P

Domain	Start	End	E-Value	Type
HLH	58	113	2.52e-11	SMART
ORANGE	140	184	5.91e-13	SMART
low complexity region	230	248	N/A	INTRINSIC
low complexity region	372	399	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137478

Predicted Effect

probably benign
Transcript: ENSMUST00000163617

SMART Domains

Protein: ENSMUSP00000132157
Gene: ENSMUSG00000030103

Domain	Start	End	E-Value	Type
HLH	58	113	2.52e-11	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000166346

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204550

Meta Mutation Damage Score

0.1204

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.1%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: This gene encodes a basic helix-loop-helix protein expressed in various tissues. The encoded protein can interact with Arntl or compete for E-box binding sites in the promoter of Per1 and repress Clock/Arntl's transactivation of Per1. This gene is believed to be involved in the control of circadian rhythm and cell differentiation. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutation of this gene results in impaired immune function and hyperplasia of the lymphoid organs. Aging mutant animals exhibit autoimmune disease. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	G	A	9: 103,282,635	R14*	probably null	Het
Acsf3	C	A	8: 122,785,955	R372S	probably damaging	Het
Adamts20	A	G	15: 94,351,721	S472P	probably benign	Het
Ccdc180	A	G	4: 45,902,486	E305G	possibly damaging	Het
Ccdc83	T	A	7: 90,236,407	R257*	probably null	Het
Cd209e	G	A	8: 3,849,212	Q167*	probably null	Het
Cd300e	G	A	11: 115,054,554	T138I	probably benign	Het
Ces2c	A	T	8: 104,849,699	M115L	probably benign	Het
Cfap61	T	A	2: 146,129,102		probably null	Het
Chd1l	G	A	3: 97,587,167	A399V	probably damaging	Het
Cic	C	T	7: 25,286,034	S301L	probably damaging	Het
Cks2	A	G	13: 51,645,459	H16R	probably benign	Het
Copa	A	T	1: 172,118,848	H953L	possibly damaging	Het
Ctdsp2	T	C	10: 126,995,880	V145A	possibly damaging	Het
Cyp2j13	A	G	4: 96,056,837	V377A	possibly damaging	Het
Dhx57	A	G	17: 80,274,805	V404A	probably benign	Het
Dock2	T	C	11: 34,707,325	S340G	probably damaging	Het
Ggps1	A	G	13: 14,057,794		probably null	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gm11444	T	C	11: 85,846,791		probably null	Het
Gm853	A	G	4: 130,221,741	S5P	probably benign	Het
Grina	A	G	15: 76,248,551	T173A	possibly damaging	Het
Hcrtr1	G	A	4: 130,135,340	T223I	probably benign	Het
Igsf10	T	A	3: 59,319,449	T2268S	probably damaging	Het
Ino80d	C	T	1: 63,062,126	R447Q	probably damaging	Het
Inpp4b	C	T	8: 81,770,833	T94M	probably damaging	Het
Itga2	A	G	13: 114,869,250	Y465H	probably damaging	Het
Knl1	A	G	2: 119,070,286	T823A	probably damaging	Het
Krtap4-16	A	G	11: 99,851,035	S180P	unknown	Het
Lpar6	A	T	14: 73,238,857	D86V	probably damaging	Het
Muc5ac	C	A	7: 141,816,864	C2500*	probably null	Het
Mzf1	T	C	7: 13,053,369		probably benign	Het
Olfr1032	G	T	2: 86,008,099	V108L	possibly damaging	Het
Olfr1176	T	A	2: 88,339,658	I31N	probably benign	Het
Olfr1311	A	C	2: 112,021,260	M198R	possibly damaging	Het
Olfr1352	T	C	10: 78,984,279	V163A	probably benign	Het
Otogl	T	G	10: 107,790,500	E1501A	probably damaging	Het
Pcdh10	T	A	3: 45,381,554	S768T	possibly damaging	Het
Pcnx2	G	T	8: 125,877,586	Q644K	probably damaging	Het
Pdzd9	T	A	7: 120,660,226	I180F	possibly damaging	Het
Pinx1	A	C	14: 63,878,172	N152T	probably benign	Het
Prr14l	T	C	5: 32,830,264	E629G	probably benign	Het
Qpctl	T	A	7: 19,148,420	I104F	probably benign	Het
Rabep1	C	T	11: 70,917,679	A444V	probably damaging	Het
Rnf150	A	G	8: 82,990,554	Y230C	probably damaging	Het
Slc25a27	A	C	17: 43,657,730	V152G	probably damaging	Het
Swt1	A	G	1: 151,384,333	S772P	possibly damaging	Het
Tenm4	A	G	7: 96,874,494	T1711A	probably benign	Het
Tfap2d	G	C	1: 19,104,478	G52R	probably benign	Het
Tmem265	T	G	7: 127,564,872	V86G	possibly damaging	Het
Trpm8	C	T	1: 88,348,332	H551Y	probably benign	Het
Ttc6	T	G	12: 57,702,262	Y1327D	possibly damaging	Het
Uevld	G	T	7: 46,937,981	Q324K	possibly damaging	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vmn2r73	C	T	7: 85,871,841	M306I	probably benign	Het
Vmn2r93	T	A	17: 18,304,104	M120K	probably benign	Het
Zfp804b	T	A	5: 6,769,908	I1016F	probably benign	Het
Zfp90	T	C	8: 106,425,394	C580R	probably damaging	Het

Other mutations in Bhlhe40

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00495:Bhlhe40	APN	6	108661178	missense	probably benign	0.25
IGL01146:Bhlhe40	APN	6	108664940	missense	possibly damaging	0.60
IGL02950:Bhlhe40	APN	6	108664542	missense	probably damaging	1.00
teedoff	UTSW	6	108664857	frame shift	probably null
R0360:Bhlhe40	UTSW	6	108664750	missense	probably damaging	1.00
R1486:Bhlhe40	UTSW	6	108664929	missense	probably damaging	1.00
R5041:Bhlhe40	UTSW	6	108662585	missense	probably damaging	0.99
R5179:Bhlhe40	UTSW	6	108665208	missense	possibly damaging	0.55
R5913:Bhlhe40	UTSW	6	108665193	missense	possibly damaging	0.79
R6281:Bhlhe40	UTSW	6	108664462	splice site	probably null
R6405:Bhlhe40	UTSW	6	108664857	frame shift	probably null
R6406:Bhlhe40	UTSW	6	108664857	frame shift	probably null
R6595:Bhlhe40	UTSW	6	108664857	frame shift	probably null
R6654:Bhlhe40	UTSW	6	108664857	frame shift	probably null
R6656:Bhlhe40	UTSW	6	108664857	frame shift	probably null
R6657:Bhlhe40	UTSW	6	108664857	frame shift	probably null
R6659:Bhlhe40	UTSW	6	108664857	frame shift	probably null
R6734:Bhlhe40	UTSW	6	108664857	frame shift	probably null
R6968:Bhlhe40	UTSW	6	108664857	frame shift	probably null
R7105:Bhlhe40	UTSW	6	108665036	missense	possibly damaging	0.96
R7323:Bhlhe40	UTSW	6	108665281	missense	probably benign	0.42
R7395:Bhlhe40	UTSW	6	108664857	frame shift	probably null
R7399:Bhlhe40	UTSW	6	108664857	frame shift	probably null
R7472:Bhlhe40	UTSW	6	108664857	frame shift	probably null
R7563:Bhlhe40	UTSW	6	108664857	frame shift	probably null
R7726:Bhlhe40	UTSW	6	108662598	missense	probably benign
R8058:Bhlhe40	UTSW	6	108664857	frame shift	probably null
R8319:Bhlhe40	UTSW	6	108664857	frame shift	probably null
R8320:Bhlhe40	UTSW	6	108664857	frame shift	probably null
R8380:Bhlhe40	UTSW	6	108664857	frame shift	probably null
R8381:Bhlhe40	UTSW	6	108664857	frame shift	probably null
R8428:Bhlhe40	UTSW	6	108664857	frame shift	probably null
R8431:Bhlhe40	UTSW	6	108664857	frame shift	probably null
R8432:Bhlhe40	UTSW	6	108664857	frame shift	probably null
R8988:Bhlhe40	UTSW	6	108662557	missense	probably damaging	1.00
R9381:Bhlhe40	UTSW	6	108665283	missense	probably damaging	1.00
R9582:Bhlhe40	UTSW	6	108661506	missense	probably benign	0.04

Predicted Primers

PCR Primer
(F):5'- CACAGACAGTGGCTATGGAG -3'
(R):5'- AGCAAGGGAGTCGGTATCTTG -3'

Sequencing Primer
(F):5'- ACAGTGGCTATGGAGGTGAATTG -3'
(R):5'- ATCTTGTCTGGGTTCATGAAGC -3'

Posted On

2018-03-15