Incidental Mutation 'R6734:Bhlhe40'
ID528339
Institutional Source Beutler Lab
Gene Symbol Bhlhe40
Ensembl Gene ENSMUSG00000030103
Gene Namebasic helix-loop-helix family, member e40
SynonymsStra13, C130042M06Rik, eip1 (E47 interaction protein 1), Sharp2, Stra14, DEC1, Bhlhb2, cytokine response gene 8, CR8, Clast5
MMRRC Submission
Accession Numbers

Genbank: NM_011498; MGI: 1097714

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6734 (G1)
Quality Score217.468
Status Validated
Chromosome6
Chromosomal Location108660629-108666925 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TG to TGG at 108664857 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000032194 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032194] [ENSMUST00000163617]
Predicted Effect probably null
Transcript: ENSMUST00000032194
SMART Domains Protein: ENSMUSP00000032194
Gene: ENSMUSG00000030103

DomainStartEndE-ValueType
HLH 58 113 2.52e-11 SMART
ORANGE 140 184 5.91e-13 SMART
low complexity region 230 248 N/A INTRINSIC
low complexity region 372 399 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137478
Predicted Effect probably benign
Transcript: ENSMUST00000163617
SMART Domains Protein: ENSMUSP00000132157
Gene: ENSMUSG00000030103

DomainStartEndE-ValueType
HLH 58 113 2.52e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166346
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204550
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 100% (52/52)
MGI Phenotype FUNCTION: This gene encodes a basic helix-loop-helix protein expressed in various tissues. The encoded protein can interact with Arntl or compete for E-box binding sites in the promoter of Per1 and repress Clock/Arntl's transactivation of Per1. This gene is believed to be involved in the control of circadian rhythm and cell differentiation. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutation of this gene results in impaired immune function and hyperplasia of the lymphoid organs. Aging mutant animals exhibit autoimmune disease. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Ano6 A G 15: 95,949,536 K554R probably damaging Het
Arhgef10 A T 8: 14,975,053 I703F probably damaging Het
Bbs1 T C 19: 4,903,896 S80G probably benign Het
Camk1 C A 6: 113,334,384 R352L probably benign Het
Cand1 G A 10: 119,211,992 P531L possibly damaging Het
Cnot2 G A 10: 116,498,153 P371S possibly damaging Het
Col24a1 C A 3: 145,508,674 P1384Q probably benign Het
Csmd2 C A 4: 128,463,813 T1689K probably benign Het
Cyp26a1 T A 19: 37,701,212 L452H probably damaging Het
Dcpp2 T C 17: 23,900,571 Y120H probably damaging Het
Dennd6a G T 14: 26,608,619 R115L possibly damaging Het
Eml2 T A 7: 19,200,507 V377E probably benign Het
Fam135b T C 15: 71,462,780 E855G probably benign Het
Fam149a A T 8: 45,381,441 I107K probably benign Het
Fam227b A T 2: 126,126,976 Y59* probably null Het
Fbn2 T C 18: 58,035,960 E2249G probably damaging Het
Flrt1 T C 19: 7,096,159 D341G possibly damaging Het
Galnt9 G A 5: 110,620,599 R587H probably damaging Het
Gm10334 T C 6: 41,445,387 Y28C probably damaging Het
Gsdma2 A G 11: 98,649,590 T112A possibly damaging Het
Klhl24 T C 16: 20,107,529 V269A probably damaging Het
Lcorl A G 5: 45,733,497 S505P probably damaging Het
Liph A G 16: 21,983,957 S121P probably damaging Het
Lrp4 G A 2: 91,485,897 V787M possibly damaging Het
Lrrd1 A C 5: 3,850,226 D177A possibly damaging Het
Mbd1 G A 18: 74,276,043 R399H probably damaging Het
Naa25 C T 5: 121,438,825 T879M possibly damaging Het
Naa35 T G 13: 59,608,191 L147R possibly damaging Het
Ninl C A 2: 150,945,083 probably null Het
Nrap T C 19: 56,345,509 D972G probably damaging Het
Olfr827 A G 10: 130,210,257 F291S probably benign Het
Pdzd2 T C 15: 12,592,465 E31G probably damaging Het
Plec C T 15: 76,194,403 E41K probably damaging Het
Plxnb1 A T 9: 109,108,920 K1245* probably null Het
Ppfia1 T C 7: 144,479,053 T1263A probably damaging Het
Prex2 G A 1: 11,080,059 V152I probably damaging Het
Prpf40b C T 15: 99,314,903 R627W probably damaging Het
Prune2 T G 19: 17,003,733 F85V probably damaging Het
Rrp1b T G 17: 32,055,304 probably benign Het
Sec62 A G 3: 30,810,460 T158A probably benign Het
Sema6a G A 18: 47,279,169 T526I probably benign Het
Shank1 G T 7: 44,353,686 A1610S probably benign Het
Slc24a4 T C 12: 102,219,000 V123A probably damaging Het
Stk11ip T C 1: 75,532,369 V714A probably benign Het
Tas1r3 T C 4: 155,860,800 T655A probably damaging Het
Tns2 G T 15: 102,103,116 L10F probably damaging Het
Trmt10c A G 16: 56,034,126 V382A probably benign Het
Unc45a G C 7: 80,336,998 T149R probably damaging Het
Zhx3 T G 2: 160,781,720 I176L probably damaging Het
Zscan12 T A 13: 21,368,796 C263* probably null Het
Other mutations in Bhlhe40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Bhlhe40 APN 6 108661178 missense probably benign 0.25
IGL01146:Bhlhe40 APN 6 108664940 missense possibly damaging 0.60
IGL02950:Bhlhe40 APN 6 108664542 missense probably damaging 1.00
teedoff UTSW 6 108664857 frame shift probably null
R0360:Bhlhe40 UTSW 6 108664750 missense probably damaging 1.00
R1486:Bhlhe40 UTSW 6 108664929 missense probably damaging 1.00
R5041:Bhlhe40 UTSW 6 108662585 missense probably damaging 0.99
R5179:Bhlhe40 UTSW 6 108665208 missense possibly damaging 0.55
R5913:Bhlhe40 UTSW 6 108665193 missense possibly damaging 0.79
R6281:Bhlhe40 UTSW 6 108664462 intron probably null
R6283:Bhlhe40 UTSW 6 108665031 missense probably damaging 1.00
R6405:Bhlhe40 UTSW 6 108664857 frame shift probably null
R6406:Bhlhe40 UTSW 6 108664857 frame shift probably null
R6595:Bhlhe40 UTSW 6 108664857 frame shift probably null
R6654:Bhlhe40 UTSW 6 108664857 frame shift probably null
R6656:Bhlhe40 UTSW 6 108664857 frame shift probably null
R6657:Bhlhe40 UTSW 6 108664857 frame shift probably null
R6659:Bhlhe40 UTSW 6 108664857 frame shift probably null
R6968:Bhlhe40 UTSW 6 108664857 frame shift probably null
R7105:Bhlhe40 UTSW 6 108665036 missense possibly damaging 0.96
R7323:Bhlhe40 UTSW 6 108665281 missense probably benign 0.42
R7395:Bhlhe40 UTSW 6 108664857 frame shift probably null
R7399:Bhlhe40 UTSW 6 108664857 frame shift probably null
R7472:Bhlhe40 UTSW 6 108664857 frame shift probably null
R7563:Bhlhe40 UTSW 6 108664857 frame shift probably null
R7726:Bhlhe40 UTSW 6 108662598 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTGAAATCTTCCCAGCTCG -3'
(R):5'- GGAACCCATCAGATCACTGC -3'

Sequencing Primer
(F):5'- TGCTTCCAGGAAACCATTGG -3'
(R):5'- TCAGATCACTGCCCGCGAAG -3'
Posted On2018-07-24