Mutagenetix > Incidental Mutation

Incidental Mutation 'R6283:Cd209e'

508054

Institutional Source

Beutler Lab

Gene Symbol

Cd209e

Ensembl Gene

ENSMUSG00000040197

Gene Name

CD209e antigen

Synonyms

mSIGNR4, SIGNR4

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.050) question?

Stock #

R6283 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

3847965-3854309 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 3849212 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 167 (Q167*)

Ref Sequence

ENSEMBL: ENSMUSP00000033888 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033888]

AlphaFold

Q91ZW7

Predicted Effect

probably null
Transcript: ENSMUST00000033888
AA Change: Q167*

SMART Domains

Protein: ENSMUSP00000033888
Gene: ENSMUSG00000040197
AA Change: Q167*

Domain	Start	End	E-Value	Type
transmembrane domain	15	37	N/A	INTRINSIC
CLECT	77	198	4.01e-33	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 94.1%

Validation Efficiency

100% (59/59)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane receptor and is often referred to as DC-SIGN because of its expression on the surface of dendritic cells and macrophages. The encoded protein is involved in the innate immune system and recognizes numerous evolutionarily divergent pathogens ranging from parasites to viruses with a large impact on public health. The protein is organized into three distinct domains: an N-terminal transmembrane domain, a tandem-repeat neck domain and C-type lectin carbohydrate recognition domain. The extracellular region consisting of the C-type lectin and neck domains has a dual function as a pathogen recognition receptor and a cell adhesion receptor by binding carbohydrate ligands on the surface of microbes and endogenous cells. The neck region is important for homo-oligomerization which allows the receptor to bind multivalent ligands with high avidity. Variations in the number of 23 amino acid repeats in the neck domain of this protein are rare but have a significant impact on ligand binding ability. This gene is closely related in terms of both sequence and function to a neighboring gene (GeneID 10332; often referred to as L-SIGN). DC-SIGN and L-SIGN differ in their ligand-binding properties and distribution. Alternative splicing results in multiple variants.[provided by RefSeq, Feb 2009]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1300017J02Rik	G	A	9: 103,282,635	R14*	probably null	Het
Acsf3	C	A	8: 122,785,955	R372S	probably damaging	Het
Adamts20	A	G	15: 94,351,721	S472P	probably benign	Het
Bhlhe40	T	C	6: 108,665,031	L312P	probably damaging	Het
Ccdc180	A	G	4: 45,902,486	E305G	possibly damaging	Het
Ccdc83	T	A	7: 90,236,407	R257*	probably null	Het
Cd300e	G	A	11: 115,054,554	T138I	probably benign	Het
Ces2c	A	T	8: 104,849,699	M115L	probably benign	Het
Cfap61	T	A	2: 146,129,102		probably null	Het
Chd1l	G	A	3: 97,587,167	A399V	probably damaging	Het
Cic	C	T	7: 25,286,034	S301L	probably damaging	Het
Cks2	A	G	13: 51,645,459	H16R	probably benign	Het
Copa	A	T	1: 172,118,848	H953L	possibly damaging	Het
Ctdsp2	T	C	10: 126,995,880	V145A	possibly damaging	Het
Cyp2j13	A	G	4: 96,056,837	V377A	possibly damaging	Het
Dhx57	A	G	17: 80,274,805	V404A	probably benign	Het
Dock2	T	C	11: 34,707,325	S340G	probably damaging	Het
Ggps1	A	G	13: 14,057,794		probably null	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gm11444	T	C	11: 85,846,791		probably null	Het
Gm853	A	G	4: 130,221,741	S5P	probably benign	Het
Grina	A	G	15: 76,248,551	T173A	possibly damaging	Het
Hcrtr1	G	A	4: 130,135,340	T223I	probably benign	Het
Igsf10	T	A	3: 59,319,449	T2268S	probably damaging	Het
Ino80d	C	T	1: 63,062,126	R447Q	probably damaging	Het
Inpp4b	C	T	8: 81,770,833	T94M	probably damaging	Het
Itga2	A	G	13: 114,869,250	Y465H	probably damaging	Het
Knl1	A	G	2: 119,070,286	T823A	probably damaging	Het
Krtap4-16	A	G	11: 99,851,035	S180P	unknown	Het
Lpar6	A	T	14: 73,238,857	D86V	probably damaging	Het
Muc5ac	C	A	7: 141,816,864	C2500*	probably null	Het
Mzf1	T	C	7: 13,053,369		probably benign	Het
Olfr1032	G	T	2: 86,008,099	V108L	possibly damaging	Het
Olfr1176	T	A	2: 88,339,658	I31N	probably benign	Het
Olfr1311	A	C	2: 112,021,260	M198R	possibly damaging	Het
Olfr1352	T	C	10: 78,984,279	V163A	probably benign	Het
Otogl	T	G	10: 107,790,500	E1501A	probably damaging	Het
Pcdh10	T	A	3: 45,381,554	S768T	possibly damaging	Het
Pcnx2	G	T	8: 125,877,586	Q644K	probably damaging	Het
Pdzd9	T	A	7: 120,660,226	I180F	possibly damaging	Het
Pinx1	A	C	14: 63,878,172	N152T	probably benign	Het
Prr14l	T	C	5: 32,830,264	E629G	probably benign	Het
Qpctl	T	A	7: 19,148,420	I104F	probably benign	Het
Rabep1	C	T	11: 70,917,679	A444V	probably damaging	Het
Rnf150	A	G	8: 82,990,554	Y230C	probably damaging	Het
Slc25a27	A	C	17: 43,657,730	V152G	probably damaging	Het
Swt1	A	G	1: 151,384,333	S772P	possibly damaging	Het
Tenm4	A	G	7: 96,874,494	T1711A	probably benign	Het
Tfap2d	G	C	1: 19,104,478	G52R	probably benign	Het
Tmem265	T	G	7: 127,564,872	V86G	possibly damaging	Het
Trpm8	C	T	1: 88,348,332	H551Y	probably benign	Het
Ttc6	T	G	12: 57,702,262	Y1327D	possibly damaging	Het
Uevld	G	T	7: 46,937,981	Q324K	possibly damaging	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Vmn2r73	C	T	7: 85,871,841	M306I	probably benign	Het
Vmn2r93	T	A	17: 18,304,104	M120K	probably benign	Het
Zfp804b	T	A	5: 6,769,908	I1016F	probably benign	Het
Zfp90	T	C	8: 106,425,394	C580R	probably damaging	Het

Other mutations in Cd209e

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00833:Cd209e	APN	8	3852800	missense	probably benign	0.05
IGL00920:Cd209e	APN	8	3849187	missense	probably damaging	1.00
IGL01132:Cd209e	APN	8	3851274	missense	probably benign	0.18
IGL02499:Cd209e	APN	8	3854238	missense	probably benign
R0124:Cd209e	UTSW	8	3851274	missense	probably benign	0.08
R0268:Cd209e	UTSW	8	3849125	missense	probably benign	0.34
R0540:Cd209e	UTSW	8	3851265	missense	probably benign	0.04
R0744:Cd209e	UTSW	8	3853205	missense	probably benign	0.00
R0836:Cd209e	UTSW	8	3853205	missense	probably benign	0.00
R1241:Cd209e	UTSW	8	3849124	missense	probably damaging	0.99
R1367:Cd209e	UTSW	8	3849084	makesense	probably null
R2040:Cd209e	UTSW	8	3849158	missense	probably damaging	1.00
R2136:Cd209e	UTSW	8	3853248	missense	probably benign	0.00
R4787:Cd209e	UTSW	8	3851181	missense	probably null	0.69
R6338:Cd209e	UTSW	8	3849154	missense	probably damaging	1.00
R6894:Cd209e	UTSW	8	3853569	missense	possibly damaging	0.48
R8899:Cd209e	UTSW	8	3851212	nonsense	probably null
R9594:Cd209e	UTSW	8	3851183	missense	probably benign	0.00
Z1176:Cd209e	UTSW	8	3849196	missense	probably benign	0.30
Z1177:Cd209e	UTSW	8	3851181	missense	probably null	0.99

Predicted Primers

PCR Primer
(F):5'- CCAACTGGGATGTTTAGGCTG -3'
(R):5'- AGACTTCATACGATGCAGGTAGC -3'

Sequencing Primer
(F):5'- ATGTTTAGGCTGTGCAAACTGC -3'
(R):5'- AAGGTCTGTCCATCACGATG -3'

Posted On

2018-03-15