Incidental Mutation 'R6283:Cic'
ID 508046
Institutional Source Beutler Lab
Gene Symbol Cic
Ensembl Gene ENSMUSG00000005442
Gene Name capicua transcriptional repressor
Synonyms 1200010B10Rik
MMRRC Submission 044453-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.949) question?
Stock # R6283 (G1)
Quality Score 110.008
Status Validated
Chromosome 7
Chromosomal Location 24967129-24993584 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 24985459 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 301 (S301L)
Ref Sequence ENSEMBL: ENSMUSP00000128071 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005578] [ENSMUST00000163320] [ENSMUST00000165239] [ENSMUST00000169266]
AlphaFold Q924A2
Predicted Effect probably damaging
Transcript: ENSMUST00000005578
AA Change: S301L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000005578
Gene: ENSMUSG00000005442
AA Change: S301L

DomainStartEndE-ValueType
PDB:4J2L|D 21 48 6e-12 PDB
low complexity region 106 120 N/A INTRINSIC
low complexity region 124 138 N/A INTRINSIC
HMG 199 269 1.24e-17 SMART
low complexity region 415 431 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 508 521 N/A INTRINSIC
low complexity region 525 555 N/A INTRINSIC
low complexity region 567 583 N/A INTRINSIC
low complexity region 645 660 N/A INTRINSIC
low complexity region 729 740 N/A INTRINSIC
low complexity region 782 803 N/A INTRINSIC
low complexity region 837 859 N/A INTRINSIC
low complexity region 939 951 N/A INTRINSIC
low complexity region 1065 1080 N/A INTRINSIC
low complexity region 1118 1132 N/A INTRINSIC
low complexity region 1135 1155 N/A INTRINSIC
low complexity region 1223 1253 N/A INTRINSIC
low complexity region 1280 1313 N/A INTRINSIC
low complexity region 1405 1418 N/A INTRINSIC
low complexity region 1483 1494 N/A INTRINSIC
low complexity region 1524 1547 N/A INTRINSIC
low complexity region 1568 1603 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000163320
AA Change: S301L

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126659
Gene: ENSMUSG00000005442
AA Change: S301L

DomainStartEndE-ValueType
PDB:4J2L|D 21 48 6e-12 PDB
low complexity region 106 120 N/A INTRINSIC
low complexity region 124 138 N/A INTRINSIC
HMG 199 269 1.24e-17 SMART
low complexity region 415 431 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 508 521 N/A INTRINSIC
low complexity region 525 555 N/A INTRINSIC
low complexity region 567 583 N/A INTRINSIC
low complexity region 645 660 N/A INTRINSIC
low complexity region 729 740 N/A INTRINSIC
low complexity region 782 803 N/A INTRINSIC
low complexity region 837 859 N/A INTRINSIC
low complexity region 939 951 N/A INTRINSIC
low complexity region 1064 1079 N/A INTRINSIC
low complexity region 1117 1131 N/A INTRINSIC
low complexity region 1134 1154 N/A INTRINSIC
low complexity region 1222 1252 N/A INTRINSIC
low complexity region 1279 1312 N/A INTRINSIC
low complexity region 1405 1418 N/A INTRINSIC
low complexity region 1483 1494 N/A INTRINSIC
low complexity region 1524 1547 N/A INTRINSIC
low complexity region 1568 1603 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163819
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164440
Predicted Effect probably damaging
Transcript: ENSMUST00000165239
AA Change: S301L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000128071
Gene: ENSMUSG00000005442
AA Change: S301L

DomainStartEndE-ValueType
PDB:4J2L|D 21 48 5e-12 PDB
low complexity region 106 120 N/A INTRINSIC
low complexity region 124 138 N/A INTRINSIC
HMG 199 269 1.24e-17 SMART
low complexity region 415 431 N/A INTRINSIC
low complexity region 473 486 N/A INTRINSIC
low complexity region 508 521 N/A INTRINSIC
low complexity region 525 555 N/A INTRINSIC
low complexity region 567 583 N/A INTRINSIC
low complexity region 645 660 N/A INTRINSIC
low complexity region 729 740 N/A INTRINSIC
low complexity region 782 803 N/A INTRINSIC
low complexity region 837 859 N/A INTRINSIC
low complexity region 939 951 N/A INTRINSIC
low complexity region 1065 1080 N/A INTRINSIC
low complexity region 1118 1132 N/A INTRINSIC
low complexity region 1135 1153 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165742
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168956
Predicted Effect probably damaging
Transcript: ENSMUST00000169266
AA Change: S1208L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000132351
Gene: ENSMUSG00000005442
AA Change: S1208L

DomainStartEndE-ValueType
low complexity region 9 23 N/A INTRINSIC
low complexity region 33 73 N/A INTRINSIC
low complexity region 151 165 N/A INTRINSIC
Pfam:DUF4819 249 346 1.8e-23 PFAM
low complexity region 351 367 N/A INTRINSIC
low complexity region 403 427 N/A INTRINSIC
low complexity region 445 457 N/A INTRINSIC
low complexity region 462 475 N/A INTRINSIC
low complexity region 618 633 N/A INTRINSIC
low complexity region 673 685 N/A INTRINSIC
low complexity region 724 734 N/A INTRINSIC
low complexity region 740 751 N/A INTRINSIC
low complexity region 779 786 N/A INTRINSIC
low complexity region 858 883 N/A INTRINSIC
low complexity region 898 911 N/A INTRINSIC
PDB:4J2L|D 930 955 5e-10 PDB
low complexity region 1013 1027 N/A INTRINSIC
low complexity region 1031 1045 N/A INTRINSIC
HMG 1106 1176 1.24e-17 SMART
low complexity region 1322 1338 N/A INTRINSIC
low complexity region 1380 1393 N/A INTRINSIC
low complexity region 1415 1428 N/A INTRINSIC
low complexity region 1432 1462 N/A INTRINSIC
low complexity region 1474 1490 N/A INTRINSIC
low complexity region 1552 1567 N/A INTRINSIC
low complexity region 1636 1647 N/A INTRINSIC
low complexity region 1689 1710 N/A INTRINSIC
low complexity region 1744 1766 N/A INTRINSIC
low complexity region 1846 1858 N/A INTRINSIC
low complexity region 1971 1986 N/A INTRINSIC
low complexity region 2024 2038 N/A INTRINSIC
low complexity region 2041 2061 N/A INTRINSIC
low complexity region 2129 2159 N/A INTRINSIC
low complexity region 2186 2219 N/A INTRINSIC
low complexity region 2311 2324 N/A INTRINSIC
low complexity region 2389 2400 N/A INTRINSIC
low complexity region 2430 2453 N/A INTRINSIC
low complexity region 2474 2509 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169743
Meta Mutation Damage Score 0.0768 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 100% (59/59)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an ortholog of the Drosophila melanogaster capicua gene, and is a member of the high mobility group (HMG)-box superfamily of transcriptional repressors. This protein contains a conserved HMG domain that is involved in DNA binding and nuclear localization, and a conserved C-terminus. Studies suggest that the N-terminal region of this protein interacts with Atxn1 (GeneID:6310), to form a transcription repressor complex, and in vitro studies suggest that polyglutamine-expansion of ATXN1 may alter the repressor activity of this complex. Mutations in this gene have been associated with olidogdendrogliomas (PMID:21817013). In addition, translocation events resulting in gene fusions of this gene with both DUX4 (GeneID:100288687) and FOXO4 (GeneID:4303) have been associated with round cell sarcomas. There are multiple pseudogenes of this gene found on chromosomes 1, 4, 6, 7, 16, 20, and the Y chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit partial postnatal lethality, decreased body size, and severe lung alveolarization defects. [provided by MGI curators]
Allele List at MGI

All alleles(61) : Targeted, other(4) Gene trapped(57)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsf3 C A 8: 123,512,694 (GRCm39) R372S probably damaging Het
Adamts20 A G 15: 94,249,602 (GRCm39) S472P probably benign Het
Bhlhe40 T C 6: 108,641,992 (GRCm39) L312P probably damaging Het
Ccdc180 A G 4: 45,902,486 (GRCm39) E305G possibly damaging Het
Ccdc83 T A 7: 89,885,615 (GRCm39) R257* probably null Het
Cd209e G A 8: 3,899,212 (GRCm39) Q167* probably null Het
Cd300e G A 11: 114,945,380 (GRCm39) T138I probably benign Het
Ces2c A T 8: 105,576,331 (GRCm39) M115L probably benign Het
Cfap61 T A 2: 145,971,022 (GRCm39) probably null Het
Chd1l G A 3: 97,494,483 (GRCm39) A399V probably damaging Het
Cks2 A G 13: 51,799,495 (GRCm39) H16R probably benign Het
Copa A T 1: 171,946,415 (GRCm39) H953L possibly damaging Het
Ctdsp2 T C 10: 126,831,749 (GRCm39) V145A possibly damaging Het
Cyp2j13 A G 4: 95,945,074 (GRCm39) V377A possibly damaging Het
Dhx57 A G 17: 80,582,234 (GRCm39) V404A probably benign Het
Dock2 T C 11: 34,598,152 (GRCm39) S340G probably damaging Het
Ggps1 A G 13: 14,232,379 (GRCm39) probably null Het
Gm10549 C A 18: 33,597,358 (GRCm39) probably benign Het
Gm11444 T C 11: 85,737,617 (GRCm39) probably null Het
Grina A G 15: 76,132,751 (GRCm39) T173A possibly damaging Het
Hcrtr1 G A 4: 130,029,133 (GRCm39) T223I probably benign Het
Igsf10 T A 3: 59,226,870 (GRCm39) T2268S probably damaging Het
Inhca G A 9: 103,159,834 (GRCm39) R14* probably null Het
Ino80d C T 1: 63,101,285 (GRCm39) R447Q probably damaging Het
Inpp4b C T 8: 82,497,462 (GRCm39) T94M probably damaging Het
Itga2 A G 13: 115,005,786 (GRCm39) Y465H probably damaging Het
Knl1 A G 2: 118,900,767 (GRCm39) T823A probably damaging Het
Krtap4-16 A G 11: 99,741,861 (GRCm39) S180P unknown Het
Ldc1 A G 4: 130,115,534 (GRCm39) S5P probably benign Het
Lpar6 A T 14: 73,476,297 (GRCm39) D86V probably damaging Het
Muc5ac C A 7: 141,370,601 (GRCm39) C2500* probably null Het
Mzf1 T C 7: 12,787,296 (GRCm39) probably benign Het
Or4f58 A C 2: 111,851,605 (GRCm39) M198R possibly damaging Het
Or5d46 T A 2: 88,170,002 (GRCm39) I31N probably benign Het
Or5m3 G T 2: 85,838,443 (GRCm39) V108L possibly damaging Het
Or7a36 T C 10: 78,820,113 (GRCm39) V163A probably benign Het
Otogl T G 10: 107,626,361 (GRCm39) E1501A probably damaging Het
Pcdh10 T A 3: 45,335,989 (GRCm39) S768T possibly damaging Het
Pcnx2 G T 8: 126,604,325 (GRCm39) Q644K probably damaging Het
Pdzd9 T A 7: 120,259,449 (GRCm39) I180F possibly damaging Het
Pinx1 A C 14: 64,115,621 (GRCm39) N152T probably benign Het
Prr14l T C 5: 32,987,608 (GRCm39) E629G probably benign Het
Qpctl T A 7: 18,882,345 (GRCm39) I104F probably benign Het
Rabep1 C T 11: 70,808,505 (GRCm39) A444V probably damaging Het
Rnf150 A G 8: 83,717,183 (GRCm39) Y230C probably damaging Het
Slc25a27 A C 17: 43,968,621 (GRCm39) V152G probably damaging Het
Swt1 A G 1: 151,260,084 (GRCm39) S772P possibly damaging Het
Tenm4 A G 7: 96,523,701 (GRCm39) T1711A probably benign Het
Tfap2d G C 1: 19,174,702 (GRCm39) G52R probably benign Het
Tmem265 T G 7: 127,164,044 (GRCm39) V86G possibly damaging Het
Trpm8 C T 1: 88,276,054 (GRCm39) H551Y probably benign Het
Ttc6 T G 12: 57,749,048 (GRCm39) Y1327D possibly damaging Het
Uevld G T 7: 46,587,729 (GRCm39) Q324K possibly damaging Het
Vmn2r111 T C 17: 22,778,032 (GRCm39) N549S possibly damaging Het
Vmn2r73 C T 7: 85,521,049 (GRCm39) M306I probably benign Het
Vmn2r93 T A 17: 18,524,366 (GRCm39) M120K probably benign Het
Zfp804b T A 5: 6,819,908 (GRCm39) I1016F probably benign Het
Zfp90 T C 8: 107,152,026 (GRCm39) C580R probably damaging Het
Other mutations in Cic
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Cic APN 7 24,991,549 (GRCm39) missense probably damaging 1.00
IGL01668:Cic APN 7 24,990,629 (GRCm39) missense possibly damaging 0.47
IGL02229:Cic APN 7 24,990,375 (GRCm39) missense probably damaging 0.96
IGL02506:Cic APN 7 24,990,282 (GRCm39) missense probably benign
IGL02794:Cic APN 7 24,985,069 (GRCm39) missense probably damaging 1.00
IGL03065:Cic APN 7 24,985,246 (GRCm39) splice site probably benign
IGL03304:Cic APN 7 24,984,274 (GRCm39) missense probably damaging 1.00
Capuccino UTSW 7 24,986,565 (GRCm39) missense probably damaging 0.98
Cassock UTSW 7 24,988,338 (GRCm39) nonsense probably null
Monkey UTSW 7 24,986,566 (GRCm39) missense probably damaging 1.00
R4850_Cic_466 UTSW 7 24,972,327 (GRCm39) missense probably damaging 0.98
1mM(1):Cic UTSW 7 24,990,214 (GRCm39) splice site probably benign
IGL03046:Cic UTSW 7 24,990,500 (GRCm39) missense probably damaging 1.00
R0012:Cic UTSW 7 24,986,566 (GRCm39) missense probably damaging 1.00
R0012:Cic UTSW 7 24,986,565 (GRCm39) missense probably damaging 0.98
R0027:Cic UTSW 7 24,986,566 (GRCm39) missense probably damaging 1.00
R0027:Cic UTSW 7 24,986,565 (GRCm39) missense probably damaging 0.98
R0038:Cic UTSW 7 24,986,566 (GRCm39) missense probably damaging 1.00
R0038:Cic UTSW 7 24,986,565 (GRCm39) missense probably damaging 0.98
R0063:Cic UTSW 7 24,986,566 (GRCm39) missense probably damaging 1.00
R0063:Cic UTSW 7 24,986,565 (GRCm39) missense probably damaging 0.98
R0064:Cic UTSW 7 24,986,566 (GRCm39) missense probably damaging 1.00
R0064:Cic UTSW 7 24,986,565 (GRCm39) missense probably damaging 0.98
R0118:Cic UTSW 7 24,985,459 (GRCm39) missense probably damaging 1.00
R0193:Cic UTSW 7 24,986,566 (GRCm39) missense probably damaging 1.00
R0193:Cic UTSW 7 24,986,565 (GRCm39) missense probably damaging 0.98
R0241:Cic UTSW 7 24,986,566 (GRCm39) missense probably damaging 1.00
R0241:Cic UTSW 7 24,986,565 (GRCm39) missense probably damaging 0.98
R0377:Cic UTSW 7 24,985,224 (GRCm39) missense probably damaging 0.98
R0462:Cic UTSW 7 24,986,565 (GRCm39) missense probably damaging 0.98
R0462:Cic UTSW 7 24,986,566 (GRCm39) missense probably damaging 1.00
R0800:Cic UTSW 7 24,984,662 (GRCm39) missense probably benign
R1253:Cic UTSW 7 24,990,373 (GRCm39) missense probably damaging 1.00
R1458:Cic UTSW 7 24,979,162 (GRCm39) intron probably benign
R1462:Cic UTSW 7 24,971,032 (GRCm39) missense probably damaging 0.98
R1462:Cic UTSW 7 24,971,032 (GRCm39) missense probably damaging 0.98
R1519:Cic UTSW 7 24,993,235 (GRCm39) critical splice acceptor site probably null
R1586:Cic UTSW 7 24,985,386 (GRCm39) missense probably damaging 1.00
R1824:Cic UTSW 7 24,987,691 (GRCm39) missense probably damaging 1.00
R1908:Cic UTSW 7 24,986,265 (GRCm39) missense probably damaging 1.00
R2045:Cic UTSW 7 24,970,961 (GRCm39) missense possibly damaging 0.53
R2063:Cic UTSW 7 24,972,876 (GRCm39) missense probably damaging 0.98
R2161:Cic UTSW 7 24,987,559 (GRCm39) splice site probably null
R2495:Cic UTSW 7 24,991,201 (GRCm39) splice site probably benign
R2865:Cic UTSW 7 24,972,646 (GRCm39) missense probably damaging 0.96
R3692:Cic UTSW 7 24,988,338 (GRCm39) nonsense probably null
R3709:Cic UTSW 7 24,986,406 (GRCm39) missense probably damaging 0.99
R3710:Cic UTSW 7 24,986,406 (GRCm39) missense probably damaging 0.99
R3872:Cic UTSW 7 24,971,124 (GRCm39) missense possibly damaging 0.92
R3946:Cic UTSW 7 24,971,771 (GRCm39) missense possibly damaging 0.93
R4199:Cic UTSW 7 24,991,095 (GRCm39) frame shift probably null
R4426:Cic UTSW 7 24,993,433 (GRCm39) utr 3 prime probably benign
R4502:Cic UTSW 7 24,987,892 (GRCm39) missense probably damaging 1.00
R4585:Cic UTSW 7 24,972,203 (GRCm39) missense probably benign 0.33
R4586:Cic UTSW 7 24,972,203 (GRCm39) missense probably benign 0.33
R4614:Cic UTSW 7 24,991,095 (GRCm39) frame shift probably null
R4664:Cic UTSW 7 24,990,099 (GRCm39) small deletion probably benign
R4688:Cic UTSW 7 24,991,095 (GRCm39) frame shift probably null
R4695:Cic UTSW 7 24,973,013 (GRCm39) missense possibly damaging 0.72
R4696:Cic UTSW 7 24,987,908 (GRCm39) missense probably benign
R4746:Cic UTSW 7 24,987,905 (GRCm39) missense probably damaging 1.00
R4758:Cic UTSW 7 24,991,636 (GRCm39) missense possibly damaging 0.62
R4767:Cic UTSW 7 24,971,025 (GRCm39) missense possibly damaging 0.92
R4776:Cic UTSW 7 24,982,308 (GRCm39) missense possibly damaging 0.95
R4820:Cic UTSW 7 24,971,157 (GRCm39) missense possibly damaging 0.92
R4850:Cic UTSW 7 24,972,327 (GRCm39) missense probably damaging 0.98
R4851:Cic UTSW 7 24,972,327 (GRCm39) missense probably damaging 0.98
R4922:Cic UTSW 7 24,991,095 (GRCm39) small insertion probably benign
R4989:Cic UTSW 7 24,986,535 (GRCm39) missense probably damaging 1.00
R5131:Cic UTSW 7 24,991,095 (GRCm39) small insertion probably benign
R5718:Cic UTSW 7 24,972,203 (GRCm39) missense probably benign 0.33
R5801:Cic UTSW 7 24,970,863 (GRCm39) missense possibly damaging 0.93
R5949:Cic UTSW 7 24,971,730 (GRCm39) missense probably damaging 1.00
R6000:Cic UTSW 7 24,971,423 (GRCm39) missense probably benign 0.33
R6246:Cic UTSW 7 24,971,067 (GRCm39) missense probably damaging 1.00
R6364:Cic UTSW 7 24,972,248 (GRCm39) missense possibly damaging 0.72
R6481:Cic UTSW 7 24,987,706 (GRCm39) missense possibly damaging 0.56
R6919:Cic UTSW 7 24,971,202 (GRCm39) missense probably benign 0.04
R6920:Cic UTSW 7 24,990,107 (GRCm39) missense probably damaging 1.00
R6995:Cic UTSW 7 24,970,736 (GRCm39) missense possibly damaging 0.53
R7002:Cic UTSW 7 24,971,621 (GRCm39) missense probably damaging 0.99
R7113:Cic UTSW 7 24,972,869 (GRCm39) missense probably benign 0.08
R7560:Cic UTSW 7 24,972,278 (GRCm39) missense probably damaging 0.98
R7680:Cic UTSW 7 24,991,856 (GRCm39) missense probably damaging 0.96
R7698:Cic UTSW 7 24,972,597 (GRCm39) missense possibly damaging 0.72
R7746:Cic UTSW 7 24,988,207 (GRCm39) missense probably damaging 1.00
R7841:Cic UTSW 7 24,985,192 (GRCm39) missense probably damaging 1.00
R7879:Cic UTSW 7 24,984,551 (GRCm39) missense probably benign 0.10
R7916:Cic UTSW 7 24,987,715 (GRCm39) missense probably damaging 0.99
R7920:Cic UTSW 7 24,971,384 (GRCm39) missense probably benign
R8056:Cic UTSW 7 24,990,366 (GRCm39) missense possibly damaging 0.90
R8226:Cic UTSW 7 24,987,213 (GRCm39) missense probably damaging 1.00
R8281:Cic UTSW 7 24,971,249 (GRCm39) missense probably benign
R8847:Cic UTSW 7 24,970,631 (GRCm39) missense probably damaging 0.98
R8991:Cic UTSW 7 24,988,885 (GRCm39) missense probably damaging 1.00
R9083:Cic UTSW 7 24,985,470 (GRCm39) missense probably damaging 0.99
R9140:Cic UTSW 7 24,985,165 (GRCm39) missense probably damaging 0.99
R9200:Cic UTSW 7 24,971,940 (GRCm39) missense probably damaging 0.99
R9208:Cic UTSW 7 24,987,502 (GRCm39) missense probably benign 0.07
R9301:Cic UTSW 7 24,991,117 (GRCm39) missense probably damaging 1.00
R9408:Cic UTSW 7 24,971,414 (GRCm39) missense possibly damaging 0.70
R9569:Cic UTSW 7 24,972,120 (GRCm39) missense possibly damaging 0.85
R9752:Cic UTSW 7 24,971,403 (GRCm39) missense probably damaging 0.96
V7732:Cic UTSW 7 24,991,670 (GRCm39) missense probably benign
Z1176:Cic UTSW 7 24,970,444 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- AATACCACGACCTGGCCTTC -3'
(R):5'- AGTGCTCAGTAAATGGCAGG -3'

Sequencing Primer
(F):5'- GGCCTTCCAGGTAATCTTTCC -3'
(R):5'- GCAGGAGGTAACAACTTGTATTTG -3'
Posted On 2018-03-15