Incidental Mutation 'R6292:Lilra5'
List |< first << previous [record 16 of 48] next >> last >|
ID508497
Institutional Source Beutler Lab
Gene Symbol Lilra5
Ensembl Gene ENSMUSG00000070873
Gene Nameleukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5
SynonymsGm4878
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R6292 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location4237754-4243463 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4238339 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 92 (S92P)
Ref Sequence ENSEMBL: ENSMUSP00000113091 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117550]
Predicted Effect possibly damaging
Transcript: ENSMUST00000117550
AA Change: S92P

PolyPhen 2 Score 0.806 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000113091
Gene: ENSMUSG00000070873
AA Change: S92P

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
IG 34 118 4.67e-4 SMART
IG_like 129 217 5.13e0 SMART
transmembrane domain 250 267 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the leukocyte immunoglobulin-like receptor (LIR) family. LIR family members are known to have activating and inibitory functions in leukocytes. Crosslink of this receptor protein on the surface of monocytes has been shown to induce calcium flux and secretion of several proinflammatory cytokines, which suggests the roles of this protein in triggering innate immune responses. This gene is one of the leukocyte receptor genes that form a gene cluster on the chromosomal region 19q13.4. Four alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb T A 5: 114,200,251 V709E probably damaging Het
Ankrd33b C T 15: 31,325,085 probably null Het
Apaf1 T C 10: 90,991,563 T1202A possibly damaging Het
Apip G T 2: 103,092,467 C210F probably benign Het
Chd9 A T 8: 90,932,922 H170L probably benign Het
Clec16a T C 16: 10,560,151 probably null Het
Ep300 T A 15: 81,616,734 probably benign Het
Etl4 C T 2: 20,743,573 H39Y probably damaging Het
Gdap1l1 A T 2: 163,451,507 I218F probably damaging Het
Gm5141 A T 13: 62,774,438 C306S probably damaging Het
Gm9961 C T 16: 11,930,472 noncoding transcript Het
Gpr27 C T 6: 99,693,658 S327L possibly damaging Het
Hectd3 A C 4: 116,998,808 T435P probably damaging Het
Hs3st1 T A 5: 39,614,790 Q170L possibly damaging Het
Hykk T C 9: 54,920,826 probably null Het
Lrig1 A T 6: 94,616,445 N418K probably damaging Het
Miga1 A G 3: 152,317,719 F232L probably benign Het
Mkrn2 T A 6: 115,613,334 M217K probably damaging Het
Myh7b A T 2: 155,632,396 Q1677L probably damaging Het
N4bp1 T C 8: 86,853,239 E645G probably damaging Het
Nckap5 T C 1: 125,915,015 K1752E probably damaging Het
Nek1 A G 8: 61,054,736 probably null Het
Ntng1 T C 3: 110,143,886 probably benign Het
Nup133 A G 8: 123,917,437 V730A probably benign Het
Olfr314 T A 11: 58,786,237 M1K probably null Het
Olfr620 T A 7: 103,612,179 H58L probably damaging Het
Paqr6 C T 3: 88,367,898 P213S probably damaging Het
Pign A T 1: 105,585,077 V627D possibly damaging Het
Rasal1 T A 5: 120,659,620 V139E probably damaging Het
Scgb1b24 G T 7: 33,744,152 A79S possibly damaging Het
Slc25a28 T C 19: 43,664,592 D210G probably benign Het
Slc38a3 A T 9: 107,655,154 I393N possibly damaging Het
Slc41a2 T C 10: 83,254,926 N465D probably damaging Het
Slc5a5 G A 8: 70,891,178 T160I probably damaging Het
Smarca2 C T 19: 26,630,892 A117V probably damaging Het
Sorcs2 C T 5: 36,062,587 R371H probably damaging Het
Taf4 A G 2: 179,923,987 S872P probably damaging Het
Tdrd3 G T 14: 87,506,254 C540F probably benign Het
Thumpd1 A T 7: 119,720,674 L23Q probably benign Het
Top1 A T 2: 160,698,141 Y213F probably benign Het
Txndc5 T C 13: 38,528,184 probably null Het
Unc79 C A 12: 103,142,732 A2005D possibly damaging Het
Upb1 T C 10: 75,438,171 L344P probably damaging Het
Vmn1r72 T A 7: 11,669,652 S290C probably benign Het
Vmn2r103 A G 17: 19,793,604 I219M possibly damaging Het
Wapl A G 14: 34,729,195 T729A probably damaging Het
Washc5 C T 15: 59,355,934 R393H probably damaging Het
Other mutations in Lilra5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02189:Lilra5 APN 7 4237969 missense probably benign
IGL02281:Lilra5 APN 7 4238783 missense probably benign 0.00
R0458:Lilra5 UTSW 7 4238219 missense probably benign 0.26
R0611:Lilra5 UTSW 7 4242233 missense probably benign
R0685:Lilra5 UTSW 7 4241957 splice site probably benign
R3195:Lilra5 UTSW 7 4238757 missense probably damaging 0.96
R4726:Lilra5 UTSW 7 4237958 missense probably benign 0.00
R4745:Lilra5 UTSW 7 4242077 missense possibly damaging 0.72
R4836:Lilra5 UTSW 7 4238714 missense possibly damaging 0.71
R6034:Lilra5 UTSW 7 4242134 missense probably benign 0.33
R6034:Lilra5 UTSW 7 4242134 missense probably benign 0.33
R6263:Lilra5 UTSW 7 4238361 missense probably damaging 1.00
R6266:Lilra5 UTSW 7 4241928 missense possibly damaging 0.84
R6285:Lilra5 UTSW 7 4242115 missense probably damaging 1.00
R6344:Lilra5 UTSW 7 4238786 missense probably damaging 1.00
R6861:Lilra5 UTSW 7 4241932 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TTTGCAGGGAATCCGCACAAG -3'
(R):5'- AAGTGGGACTATCCAGGCTG -3'

Sequencing Primer
(F):5'- AACCCTTAGTGTTCAGCCAGG -3'
(R):5'- GACTATCCAGGCTGCATTGC -3'
Posted On2018-03-15