Incidental Mutation 'R6299:Nectin3'
ID508998
Institutional Source Beutler Lab
Gene Symbol Nectin3
Ensembl Gene ENSMUSG00000022656
Gene Namenectin cell adhesion molecule 3
Synonyms3000002N23Rik, 2610301B19Rik, nectin-3, 4921513D19Rik, Pvrl3
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.338) question?
Stock #R6299 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location46387706-46498525 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 46463982 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 113 (V113A)
Ref Sequence ENSEMBL: ENSMUSP00000093757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023334] [ENSMUST00000023335] [ENSMUST00000096052]
Predicted Effect probably damaging
Transcript: ENSMUST00000023334
AA Change: V113A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023334
Gene: ENSMUSG00000022656
AA Change: V113A

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
IG 63 167 5.04e-9 SMART
Pfam:C2-set_2 173 257 1.5e-19 PFAM
Pfam:Ig_3 284 342 3.1e-6 PFAM
low complexity region 358 367 N/A INTRINSIC
transmembrane domain 404 426 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000023335
AA Change: V113A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000023335
Gene: ENSMUSG00000022656
AA Change: V113A

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
IG 63 167 5.04e-9 SMART
Pfam:C2-set_2 173 257 2.5e-19 PFAM
Pfam:Ig_2 281 355 1.3e-6 PFAM
transmembrane domain 368 390 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000096052
AA Change: V113A

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000093757
Gene: ENSMUSG00000022656
AA Change: V113A

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
IG 63 167 5.04e-9 SMART
Pfam:C2-set_2 173 257 2e-19 PFAM
Pfam:Ig_2 281 355 1e-6 PFAM
transmembrane domain 368 390 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133935
Predicted Effect unknown
Transcript: ENSMUST00000149901
AA Change: V112A
SMART Domains Protein: ENSMUSP00000117479
Gene: ENSMUSG00000022656
AA Change: V112A

DomainStartEndE-ValueType
low complexity region 24 48 N/A INTRINSIC
IG 63 167 5.04e-9 SMART
Pfam:Ig_3 184 243 4.8e-5 PFAM
Meta Mutation Damage Score 0.2168 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the nectin family of proteins, which function as adhesion molecules at adherens junctions. This family member interacts with other nectin-like proteins and with afadin, a filamentous actin-binding protein involved in the regulation of directional motility, cell proliferation and survival. This gene plays a role in ocular development involving the ciliary body. Mutations in this gene are believed to result in congenital ocular defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice exhibit male infertility and eye abnormalities including microphthalmia, absent vitreous body, abnormal ciliary body, retinal layers, and lenses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bms1 G A 6: 118,418,515 R24W probably damaging Het
C130050O18Rik A T 5: 139,414,371 S60C probably damaging Het
Cabcoco1 A G 10: 68,436,890 Y222H probably damaging Het
Cc2d1b T C 4: 108,628,138 V559A probably benign Het
Cgrrf1 T A 14: 46,840,190 N46K probably damaging Het
Clca3a1 T C 3: 144,758,514 D114G probably damaging Het
Clcnkb T A 4: 141,410,723 L279F probably damaging Het
Cr2 T C 1: 195,168,646 T151A probably damaging Het
Creb3l3 C T 10: 81,088,613 E236K probably damaging Het
Dcstamp T A 15: 39,755,203 V336D probably damaging Het
Dopey1 T G 9: 86,504,212 F379V probably damaging Het
Esf1 T C 2: 140,123,634 K714R possibly damaging Het
Exoc3l4 A T 12: 111,422,079 M1L possibly damaging Het
Extl3 T C 14: 65,076,672 R354G probably benign Het
Fastkd3 T C 13: 68,587,736 L535P probably damaging Het
Gab2 A G 7: 97,081,859 T12A probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Golga4 T A 9: 118,557,370 S1187T probably benign Het
Haus3 A G 5: 34,167,796 V173A probably benign Het
Herc2 T A 7: 56,135,055 Y1416N possibly damaging Het
Hspg2 A G 4: 137,544,705 Y2566C probably damaging Het
Inpp5f A T 7: 128,636,160 T34S possibly damaging Het
Iqck G A 7: 118,876,262 G70S unknown Het
Jade1 T C 3: 41,613,725 F743L probably damaging Het
Kif5a T C 10: 127,233,821 K845R probably damaging Het
Klhl30 A G 1: 91,357,914 probably null Het
Map2k1 T C 9: 64,214,490 D67G possibly damaging Het
Mcm9 A C 10: 53,537,681 C434W probably damaging Het
Muc4 T G 16: 32,752,035 S638A possibly damaging Het
Nfya T C 17: 48,392,910 probably benign Het
Nup155 G T 15: 8,128,438 A460S possibly damaging Het
Nup210 T C 6: 91,074,288 E371G possibly damaging Het
Olfm3 T C 3: 115,120,983 S228P probably damaging Het
Olfr659 C A 7: 104,670,868 D55E probably benign Het
Olfr916 A T 9: 38,657,777 I205N possibly damaging Het
Plin1 A C 7: 79,721,476 V500G probably benign Het
Ppfia1 A C 7: 144,510,312 M513R probably benign Het
Ppp1cb T A 5: 32,483,454 C27* probably null Het
Prss22 T A 17: 23,996,434 I123F probably damaging Het
Rbm24 G T 13: 46,419,073 V15L probably damaging Het
Reln T C 5: 22,286,944 T97A possibly damaging Het
Sipa1l2 T C 8: 125,453,464 T1065A possibly damaging Het
Sipa1l3 A C 7: 29,366,549 probably null Het
Snrnp200 T A 2: 127,222,161 Y689* probably null Het
Srcap T C 7: 127,530,454 probably benign Het
Sv2a T C 3: 96,188,249 probably null Het
Tcf12 A T 9: 71,858,929 V474D probably damaging Het
Tpcn2 A T 7: 145,262,243 S403T probably damaging Het
Trim65 C A 11: 116,126,551 A362S probably benign Het
Trmt1 T A 8: 84,697,290 C36* probably null Het
Trpm8 T A 1: 88,354,479 L699Q probably damaging Het
Ube2m A C 7: 13,035,870 I116R probably damaging Het
Ulk1 T C 5: 110,791,097 K492E possibly damaging Het
Usp40 T A 1: 87,997,927 K193N probably damaging Het
Vmn1r3 A G 4: 3,185,098 S70P possibly damaging Het
Vmn2r2 T A 3: 64,116,653 K836* probably null Het
Vmn2r75 T A 7: 86,165,274 H337L probably benign Het
Wars G A 12: 108,861,383 T437M probably benign Het
Zdhhc5 T C 2: 84,690,481 T451A probably benign Het
Zfp788 T G 7: 41,648,541 H180Q possibly damaging Het
Zkscan7 A G 9: 122,888,717 E59G probably damaging Het
Other mutations in Nectin3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01456:Nectin3 APN 16 46458853 missense probably benign 0.23
R0373:Nectin3 UTSW 16 46458187 missense probably damaging 0.99
R0550:Nectin3 UTSW 16 46458820 missense possibly damaging 0.86
R1219:Nectin3 UTSW 16 46454679 nonsense probably null
R1251:Nectin3 UTSW 16 46463842 missense possibly damaging 0.82
R1398:Nectin3 UTSW 16 46448756 missense possibly damaging 0.95
R1439:Nectin3 UTSW 16 46448394 nonsense probably null
R2250:Nectin3 UTSW 16 46454736 missense probably benign 0.00
R2448:Nectin3 UTSW 16 46448515 unclassified probably null
R2483:Nectin3 UTSW 16 46395179 missense possibly damaging 0.83
R4523:Nectin3 UTSW 16 46448590 missense probably benign 0.15
R4709:Nectin3 UTSW 16 46463943 missense possibly damaging 0.58
R4809:Nectin3 UTSW 16 46448160 intron probably benign
R4884:Nectin3 UTSW 16 46448886 missense probably benign 0.01
R5051:Nectin3 UTSW 16 46448550 missense possibly damaging 0.95
R5061:Nectin3 UTSW 16 46448449 missense probably benign 0.03
R5272:Nectin3 UTSW 16 46448476 missense possibly damaging 0.82
R5365:Nectin3 UTSW 16 46464106 nonsense probably null
R5768:Nectin3 UTSW 16 46458817 missense probably damaging 0.98
R5987:Nectin3 UTSW 16 46464145 missense probably benign 0.00
R6029:Nectin3 UTSW 16 46436400 missense probably benign 0.08
R6131:Nectin3 UTSW 16 46395152 missense probably damaging 0.98
R6251:Nectin3 UTSW 16 46395150 missense probably damaging 0.99
R6347:Nectin3 UTSW 16 46458124 missense probably benign 0.01
R6360:Nectin3 UTSW 16 46411109 missense probably benign 0.09
R6505:Nectin3 UTSW 16 46448821 missense possibly damaging 0.68
R6703:Nectin3 UTSW 16 46463842 missense probably damaging 0.99
R6869:Nectin3 UTSW 16 46395143 missense probably damaging 0.96
R7184:Nectin3 UTSW 16 46395121 missense possibly damaging 0.66
R7298:Nectin3 UTSW 16 46448396 missense probably damaging 1.00
R7455:Nectin3 UTSW 16 46496742 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGAGAGCCTAGACATACACAGC -3'
(R):5'- TTAGCTGGATCAATTATTGTGGAGC -3'

Sequencing Primer
(F):5'- GAGCCTAGACATACACAGCTTTAAG -3'
(R):5'- TGGAGCCACATGTCACAGCAG -3'
Posted On2018-04-02