Incidental Mutation 'R6521:Tas2r119'
ID521312
Institutional Source Beutler Lab
Gene Symbol Tas2r119
Ensembl Gene ENSMUSG00000045267
Gene Nametaste receptor, type 2, member 119
SynonymsmGR19, T2R19, mt2r19, Tas2r19
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6521 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location32177289-32178294 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 32178173 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 295 (C295Y)
Ref Sequence ENSEMBL: ENSMUSP00000050277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057633]
Predicted Effect probably damaging
Transcript: ENSMUST00000057633
AA Change: C295Y

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000050277
Gene: ENSMUSG00000045267
AA Change: C295Y

DomainStartEndE-ValueType
Pfam:TAS2R 1 293 1.1e-90 PFAM
Meta Mutation Damage Score 0.3619 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of candidate taste receptors that are members of the G protein-coupled receptor superfamily and that are specifically expressed by taste receptor cells of the tongue and palate epithelia. This intronless taste receptor gene encodes a 7-transmembrane receptor protein, functioning as a bitter taste receptor. This gene is mapped to chromosome 5p15, the location of a genetic locus (PROP) that controls the detection of the bitter compound 6-n-propyl-2-thiouracil. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aars T A 8: 111,043,336 S356T probably benign Het
Acsbg2 T C 17: 56,861,565 M185V probably benign Het
Adgrv1 A T 13: 81,433,652 F4758I probably damaging Het
Ank3 A G 10: 69,992,766 probably benign Het
Ankfy1 G A 11: 72,730,482 R198Q possibly damaging Het
Ano4 A G 10: 88,983,778 V537A probably damaging Het
Catsper2 A G 2: 121,406,807 L204P probably damaging Het
Cdh20 A C 1: 104,942,134 D193A probably damaging Het
Ceacam5 T C 7: 17,750,831 probably null Het
Celf4 T A 18: 25,479,474 probably null Het
Crebbp A T 16: 4,119,128 F754I probably damaging Het
Cyfip2 A T 11: 46,254,588 I635N probably damaging Het
Erbb4 T A 1: 68,042,530 D1131V probably damaging Het
Fsip2 A G 2: 82,990,086 T5388A possibly damaging Het
Hoxc8 G A 15: 102,992,703 V193M probably benign Het
Klhdc3 A G 17: 46,677,761 V124A probably benign Het
Klhl18 A G 9: 110,428,635 I509T possibly damaging Het
Maats1 A G 16: 38,306,759 V545A probably benign Het
Mdfic T A 6: 15,729,028 probably benign Het
Mkln1 T A 6: 31,490,544 D64E probably damaging Het
Mmd2 A G 5: 142,574,830 I112T probably damaging Het
Mpl C T 4: 118,455,117 probably null Het
Mtmr4 A G 11: 87,613,527 T1044A possibly damaging Het
Muc5b C A 7: 141,859,171 Y1951* probably null Het
Myo15 C T 11: 60,502,369 H2240Y probably damaging Het
Nckap5 A T 1: 126,382,172 I74K probably damaging Het
Nfxl1 A T 5: 72,540,308 probably null Het
Olfr1018 A T 2: 85,823,450 I160F probably benign Het
Olfr1205 A G 2: 88,831,356 I80V probably benign Het
Olfr736 T C 14: 50,393,548 V264A possibly damaging Het
Olfr924 C T 9: 38,848,597 T161I probably benign Het
Piezo2 T C 18: 63,021,328 Y2460C probably damaging Het
Pigx A G 16: 32,087,311 L64P probably damaging Het
Prss1 C T 6: 41,463,681 T230I probably damaging Het
Ptma A G 1: 86,527,847 probably null Het
Rab39 T C 9: 53,706,031 T29A probably benign Het
Rem2 C T 14: 54,477,687 A107V possibly damaging Het
Senp1 A G 15: 98,048,271 V531A probably damaging Het
Serhl A G 15: 83,101,642 probably null Het
Sirpa T G 2: 129,630,155 Y164D probably damaging Het
Slc12a3 T C 8: 94,343,113 I550T possibly damaging Het
Slc22a14 T C 9: 119,220,769 probably null Het
Slfn5 A G 11: 82,960,415 N513D probably damaging Het
Sptan1 T C 2: 30,020,455 S1831P possibly damaging Het
Swap70 T C 7: 110,255,820 L109P probably benign Het
Tcaf3 T A 6: 42,593,238 I527L probably damaging Het
Traj31 A G 14: 54,187,930 probably benign Het
Unc5a T A 13: 55,004,935 D887E probably benign Het
Zfp407 T A 18: 84,432,411 H1600L probably damaging Het
Other mutations in Tas2r119
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Tas2r119 APN 15 32177453 missense probably damaging 0.97
IGL01522:Tas2r119 APN 15 32178193 missense probably benign 0.15
IGL01548:Tas2r119 APN 15 32177977 missense probably damaging 1.00
IGL01826:Tas2r119 APN 15 32177402 missense probably damaging 1.00
IGL02432:Tas2r119 APN 15 32177707 missense probably benign 0.06
IGL02585:Tas2r119 APN 15 32177533 missense probably benign 0.04
R2248:Tas2r119 UTSW 15 32178151 missense possibly damaging 0.51
R2432:Tas2r119 UTSW 15 32178019 missense possibly damaging 0.80
R5098:Tas2r119 UTSW 15 32178082 missense probably benign 0.03
R5624:Tas2r119 UTSW 15 32177968 missense probably damaging 1.00
R5819:Tas2r119 UTSW 15 32177306 missense probably damaging 1.00
R5901:Tas2r119 UTSW 15 32177786 missense possibly damaging 0.84
R6363:Tas2r119 UTSW 15 32177888 missense possibly damaging 0.91
R6495:Tas2r119 UTSW 15 32177530 missense probably benign
R7574:Tas2r119 UTSW 15 32178133 missense probably damaging 1.00
X0063:Tas2r119 UTSW 15 32178155 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GTCAGTGCGATGCTCTCCATTC -3'
(R):5'- GTTGGGCTTTGATCATCAATTTACCC -3'

Sequencing Primer
(F):5'- ATCCTCTATCTCTCCCATGACATG -3'
(R):5'- CCCTTTGAAATGATTAAGCCTCAGG -3'
Posted On2018-06-06