Incidental Mutation 'R6370:Olfr568'
ID513474
Institutional Source Beutler Lab
Gene Symbol Olfr568
Ensembl Gene ENSMUSG00000073965
Gene Nameolfactory receptor 568
SynonymsMOR14-3, MOR14-11, GA_x6K02T2PBJ9-5588278-5589228
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R6370 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location102877122-102878063 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102877170 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 17 (T17S)
Ref Sequence ENSEMBL: ENSMUSP00000095818 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098216]
Predicted Effect probably benign
Transcript: ENSMUST00000098216
AA Change: T17S

PolyPhen 2 Score 0.428 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000095818
Gene: ENSMUSG00000073965
AA Change: T17S

DomainStartEndE-ValueType
Pfam:7tm_4 32 309 7.6e-113 PFAM
Pfam:7TM_GPCR_Srsx 34 306 1.8e-7 PFAM
Pfam:7tm_1 40 291 1e-20 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 95% (54/57)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb6 A G 2: 30,827,012 V67A probably damaging Het
Atic T A 1: 71,578,660 F590I probably damaging Het
Atxn10 T C 15: 85,393,385 F351S probably damaging Het
Bcl2l13 A G 6: 120,865,622 N92S probably benign Het
Carm1 G T 9: 21,587,519 A518S probably benign Het
Ccar1 C T 10: 62,764,529 R541H probably damaging Het
Cfhr2 A T 1: 139,822,327 L96Q probably damaging Het
Chrnb4 A G 9: 55,034,859 L377S probably benign Het
Clcn3 A G 8: 60,923,024 Y639H probably damaging Het
Cngb1 C T 8: 95,264,422 M717I probably benign Het
Ctcf T C 8: 105,664,220 M153T probably benign Het
Cyp2b19 T C 7: 26,763,358 S222P probably benign Het
Dixdc1 A T 9: 50,682,223 probably null Het
Entpd2 G A 2: 25,397,417 G47S probably damaging Het
Erbb3 A G 10: 128,570,074 M1158T possibly damaging Het
Faah T C 4: 116,003,056 D333G probably damaging Het
Foxred2 T A 15: 77,943,306 T618S probably benign Het
Gm2381 G A 7: 42,820,586 A38V probably benign Het
Gpx5 A T 13: 21,288,702 probably null Het
Gtdc1 A G 2: 44,756,322 V98A probably damaging Het
Hal T C 10: 93,497,506 I312T probably damaging Het
Krtap21-1 T C 16: 89,403,631 Y41C unknown Het
Larp6 A G 9: 60,737,363 E262G probably damaging Het
Lrrn1 A G 6: 107,569,224 Y661C probably damaging Het
Lsm14a A G 7: 34,357,481 V244A probably benign Het
Marc1 T C 1: 184,795,492 D257G probably damaging Het
Mfrp T C 9: 44,106,261 C517R probably damaging Het
Ncoa3 T C 2: 166,065,905 S1145P probably benign Het
Nosip G T 7: 45,076,740 probably null Het
Olfr1186 T A 2: 88,499,368 C94* probably null Het
Olfr664 T C 7: 104,733,917 K149R probably benign Het
Phykpl T C 11: 51,586,716 S112P probably damaging Het
Pik3cb A T 9: 99,040,934 I1015K probably damaging Het
Pomt2 A G 12: 87,109,199 W818R probably damaging Het
Ptpn21 A T 12: 98,689,034 M558K possibly damaging Het
Rnf213 T A 11: 119,477,078 N4647K probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,579,907 probably benign Homo
Rxrg T C 1: 167,634,437 V227A probably damaging Het
Satb1 A T 17: 51,782,797 S341T possibly damaging Het
Skint5 T G 4: 113,614,110 Q983P unknown Het
Slc6a18 G A 13: 73,668,159 T367I probably benign Het
Slc7a1 A G 5: 148,340,673 L344P probably damaging Het
Slc7a6 T A 8: 106,195,437 F399I probably benign Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Sugt1 T C 14: 79,610,334 V208A probably benign Het
Syt3 A G 7: 44,395,683 K480E probably damaging Het
Thop1 C T 10: 81,077,983 T186I probably benign Het
Trim55 G A 3: 19,691,486 E509K possibly damaging Het
Upf2 A G 2: 5,976,010 N469S unknown Het
Usp24 G T 4: 106,380,521 K1125N probably null Het
Usp5 A T 6: 124,820,428 D494E probably benign Het
Vmn2r51 T C 7: 10,098,216 K481R probably damaging Het
Vps16 C A 2: 130,443,384 A787D probably damaging Het
Washc4 C T 10: 83,571,362 H488Y possibly damaging Het
Wdfy4 C A 14: 33,068,850 A2053S probably benign Het
Zfp74 A T 7: 29,932,410 D136E probably damaging Het
Other mutations in Olfr568
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01682:Olfr568 APN 7 102877233 missense probably benign 0.02
IGL02349:Olfr568 APN 7 102877909 missense probably benign 0.06
IGL02421:Olfr568 APN 7 102877759 missense probably damaging 1.00
IGL03179:Olfr568 APN 7 102878072 unclassified probably benign
FR4737:Olfr568 UTSW 7 102877233 small insertion probably benign
R0003:Olfr568 UTSW 7 102877861 missense probably benign 0.02
R0126:Olfr568 UTSW 7 102877140 missense probably benign 0.25
R1435:Olfr568 UTSW 7 102877767 missense probably damaging 1.00
R1585:Olfr568 UTSW 7 102877773 missense probably benign 0.00
R1660:Olfr568 UTSW 7 102877656 missense probably damaging 1.00
R1678:Olfr568 UTSW 7 102877663 missense probably damaging 1.00
R2010:Olfr568 UTSW 7 102877685 nonsense probably null
R4706:Olfr568 UTSW 7 102877433 missense probably damaging 1.00
R5490:Olfr568 UTSW 7 102877893 missense probably damaging 1.00
R5632:Olfr568 UTSW 7 102877797 missense probably benign 0.00
R6675:Olfr568 UTSW 7 102877273 missense possibly damaging 0.89
R7854:Olfr568 UTSW 7 102877785 nonsense probably null
R7937:Olfr568 UTSW 7 102877785 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AAGCAAGAAGAGAAGCCTACATTTC -3'
(R):5'- CGAGCTTCAAACCAGAGGAC -3'

Sequencing Primer
(F):5'- GATTAAGTGCTAGAGAGATGT -3'
(R):5'- TTCAAACCAGAGGACACCAAGGG -3'
Posted On2018-04-27