Incidental Mutation 'R6370:Vps16'
ID 513456
Institutional Source Beutler Lab
Gene Symbol Vps16
Ensembl Gene ENSMUSG00000027411
Gene Name VSP16 CORVET/HOPS core subunit
Synonyms 1810074M16Rik
MMRRC Submission 044520-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.971) question?
Stock # R6370 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 130266259-130286189 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 130285304 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Aspartic acid at position 787 (A787D)
Ref Sequence ENSEMBL: ENSMUSP00000028900 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028900] [ENSMUST00000128994]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000028900
AA Change: A787D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028900
Gene: ENSMUSG00000027411
AA Change: A787D

DomainStartEndE-ValueType
Pfam:Vps16_N 4 420 1e-166 PFAM
low complexity region 452 462 N/A INTRINSIC
Pfam:Vps16_C 517 835 5.5e-150 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125098
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125973
Predicted Effect probably benign
Transcript: ENSMUST00000128994
SMART Domains Protein: ENSMUSP00000115899
Gene: ENSMUSG00000027411

DomainStartEndE-ValueType
Pfam:Vps16_N 4 212 3.2e-74 PFAM
Pfam:Vps16_N 205 316 1e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131220
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132388
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134677
Meta Mutation Damage Score 0.7985 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.1%
Validation Efficiency 95% (54/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Vesicle mediated protein sorting plays an important role in segregation of intracellular molecules into distinct organelles. Genetic studies in yeast have identified more than 40 vacuolar protein sorting (VPS) genes involved in vesicle transport to vacuoles. This gene encodes the human homolog of yeast class C Vps16 protein. The mammalian class C Vps proteins are predominantly associated with late endosomes/lysosomes, and like their yeast counterparts, may mediate vesicle trafficking steps in the endosome/lysosome pathway. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice with a homozygous point mutation in exon 3 display impaired motor function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Asb6 A G 2: 30,717,024 (GRCm39) V67A probably damaging Het
Atic T A 1: 71,617,819 (GRCm39) F590I probably damaging Het
Atxn10 T C 15: 85,277,586 (GRCm39) F351S probably damaging Het
Bcl2l13 A G 6: 120,842,583 (GRCm39) N92S probably benign Het
Carm1 G T 9: 21,498,815 (GRCm39) A518S probably benign Het
Ccar1 C T 10: 62,600,308 (GRCm39) R541H probably damaging Het
Cfhr2 A T 1: 139,750,065 (GRCm39) L96Q probably damaging Het
Chrnb4 A G 9: 54,942,143 (GRCm39) L377S probably benign Het
Clcn3 A G 8: 61,376,058 (GRCm39) Y639H probably damaging Het
Cngb1 C T 8: 95,991,050 (GRCm39) M717I probably benign Het
Ctcf T C 8: 106,390,852 (GRCm39) M153T probably benign Het
Cyp2b19 T C 7: 26,462,783 (GRCm39) S222P probably benign Het
Dixdc1 A T 9: 50,593,523 (GRCm39) probably null Het
Entpd2 G A 2: 25,287,429 (GRCm39) G47S probably damaging Het
Erbb3 A G 10: 128,405,943 (GRCm39) M1158T possibly damaging Het
Faah T C 4: 115,860,253 (GRCm39) D333G probably damaging Het
Foxred2 T A 15: 77,827,506 (GRCm39) T618S probably benign Het
Gm2381 G A 7: 42,470,010 (GRCm39) A38V probably benign Het
Gpx5 A T 13: 21,472,872 (GRCm39) probably null Het
Gtdc1 A G 2: 44,646,334 (GRCm39) V98A probably damaging Het
Hal T C 10: 93,333,368 (GRCm39) I312T probably damaging Het
Krtap21-1 T C 16: 89,200,519 (GRCm39) Y41C unknown Het
Larp6 A G 9: 60,644,646 (GRCm39) E262G probably damaging Het
Lrrn1 A G 6: 107,546,185 (GRCm39) Y661C probably damaging Het
Lsm14a A G 7: 34,056,906 (GRCm39) V244A probably benign Het
Mfrp T C 9: 44,017,558 (GRCm39) C517R probably damaging Het
Mtarc1 T C 1: 184,527,689 (GRCm39) D257G probably damaging Het
Ncoa3 T C 2: 165,907,825 (GRCm39) S1145P probably benign Het
Nosip G T 7: 44,726,164 (GRCm39) probably null Het
Or4c100 T A 2: 88,329,712 (GRCm39) C94* probably null Het
Or51f2 A T 7: 102,526,377 (GRCm39) T17S probably benign Het
Or52n1 T C 7: 104,383,124 (GRCm39) K149R probably benign Het
Phykpl T C 11: 51,477,543 (GRCm39) S112P probably damaging Het
Pik3cb A T 9: 98,922,987 (GRCm39) I1015K probably damaging Het
Pomt2 A G 12: 87,155,973 (GRCm39) W818R probably damaging Het
Ptpn21 A T 12: 98,655,293 (GRCm39) M558K possibly damaging Het
Rnf213 T A 11: 119,367,904 (GRCm39) N4647K probably damaging Het
Rsf1 GCG GCGACGGCGACG 7: 97,229,114 (GRCm39) probably benign Homo
Rxrg T C 1: 167,462,006 (GRCm39) V227A probably damaging Het
Satb1 A T 17: 52,089,825 (GRCm39) S341T possibly damaging Het
Skint5 T G 4: 113,471,307 (GRCm39) Q983P unknown Het
Slc6a18 G A 13: 73,816,278 (GRCm39) T367I probably benign Het
Slc7a1 A G 5: 148,277,483 (GRCm39) L344P probably damaging Het
Slc7a6 T A 8: 106,922,069 (GRCm39) F399I probably benign Het
St3gal1 A G 15: 66,983,195 (GRCm39) V187A possibly damaging Het
Sugt1 T C 14: 79,847,774 (GRCm39) V208A probably benign Het
Syt3 A G 7: 44,045,107 (GRCm39) K480E probably damaging Het
Thop1 C T 10: 80,913,817 (GRCm39) T186I probably benign Het
Trim55 G A 3: 19,745,650 (GRCm39) E509K possibly damaging Het
Upf2 A G 2: 5,980,821 (GRCm39) N469S unknown Het
Usp24 G T 4: 106,237,718 (GRCm39) K1125N probably null Het
Usp5 A T 6: 124,797,391 (GRCm39) D494E probably benign Het
Vmn2r51 T C 7: 9,832,143 (GRCm39) K481R probably damaging Het
Washc4 C T 10: 83,407,226 (GRCm39) H488Y possibly damaging Het
Wdfy4 C A 14: 32,790,807 (GRCm39) A2053S probably benign Het
Zfp74 A T 7: 29,631,835 (GRCm39) D136E probably damaging Het
Other mutations in Vps16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Vps16 APN 2 130,279,616 (GRCm39) missense probably benign 0.19
IGL01400:Vps16 APN 2 130,280,273 (GRCm39) missense possibly damaging 0.73
IGL01542:Vps16 APN 2 130,280,314 (GRCm39) missense probably damaging 0.97
IGL02011:Vps16 APN 2 130,283,399 (GRCm39) missense probably benign 0.04
IGL02192:Vps16 APN 2 130,282,852 (GRCm39) missense probably damaging 0.98
IGL02220:Vps16 APN 2 130,283,573 (GRCm39) missense possibly damaging 0.85
IGL02587:Vps16 APN 2 130,281,636 (GRCm39) critical splice donor site probably null
R0427:Vps16 UTSW 2 130,280,770 (GRCm39) missense probably benign 0.00
R0507:Vps16 UTSW 2 130,279,632 (GRCm39) critical splice donor site probably null
R1550:Vps16 UTSW 2 130,282,260 (GRCm39) missense probably benign 0.09
R1789:Vps16 UTSW 2 130,285,520 (GRCm39) missense probably benign 0.42
R3895:Vps16 UTSW 2 130,280,596 (GRCm39) missense possibly damaging 0.96
R3981:Vps16 UTSW 2 130,284,514 (GRCm39) missense possibly damaging 0.77
R4092:Vps16 UTSW 2 130,281,832 (GRCm39) missense probably damaging 1.00
R4555:Vps16 UTSW 2 130,285,496 (GRCm39) missense probably damaging 1.00
R4569:Vps16 UTSW 2 130,284,124 (GRCm39) missense probably benign
R4803:Vps16 UTSW 2 130,280,030 (GRCm39) missense probably benign 0.27
R4835:Vps16 UTSW 2 130,280,220 (GRCm39) splice site probably benign
R5022:Vps16 UTSW 2 130,281,372 (GRCm39) missense probably benign 0.07
R5023:Vps16 UTSW 2 130,281,372 (GRCm39) missense probably benign 0.07
R5057:Vps16 UTSW 2 130,281,372 (GRCm39) missense probably benign 0.07
R5158:Vps16 UTSW 2 130,283,199 (GRCm39) missense probably damaging 1.00
R5177:Vps16 UTSW 2 130,285,288 (GRCm39) nonsense probably null
R5540:Vps16 UTSW 2 130,284,305 (GRCm39) missense probably benign 0.00
R5680:Vps16 UTSW 2 130,282,244 (GRCm39) missense possibly damaging 0.64
R5689:Vps16 UTSW 2 130,281,011 (GRCm39) nonsense probably null
R5690:Vps16 UTSW 2 130,281,011 (GRCm39) nonsense probably null
R5926:Vps16 UTSW 2 130,285,476 (GRCm39) missense probably damaging 0.97
R5992:Vps16 UTSW 2 130,266,369 (GRCm39) critical splice donor site probably null
R6135:Vps16 UTSW 2 130,280,573 (GRCm39) missense possibly damaging 0.57
R6898:Vps16 UTSW 2 130,279,601 (GRCm39) missense possibly damaging 0.74
R7378:Vps16 UTSW 2 130,280,099 (GRCm39) missense probably damaging 1.00
R7487:Vps16 UTSW 2 130,280,977 (GRCm39) nonsense probably null
R7641:Vps16 UTSW 2 130,282,448 (GRCm39) missense probably benign 0.28
R7720:Vps16 UTSW 2 130,283,623 (GRCm39) nonsense probably null
R8246:Vps16 UTSW 2 130,280,793 (GRCm39) missense probably damaging 1.00
R8363:Vps16 UTSW 2 130,284,161 (GRCm39) missense probably benign 0.08
R9092:Vps16 UTSW 2 130,281,593 (GRCm39) missense probably damaging 0.99
R9128:Vps16 UTSW 2 130,266,319 (GRCm39) missense possibly damaging 0.51
R9352:Vps16 UTSW 2 130,283,823 (GRCm39) critical splice donor site probably null
R9406:Vps16 UTSW 2 130,283,425 (GRCm39) critical splice donor site probably null
R9508:Vps16 UTSW 2 130,284,361 (GRCm39) missense possibly damaging 0.94
R9800:Vps16 UTSW 2 130,282,405 (GRCm39) missense probably benign 0.02
RF021:Vps16 UTSW 2 130,280,129 (GRCm39) missense probably benign 0.09
Z1177:Vps16 UTSW 2 130,283,346 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTATGGGCAAGTGTCCTC -3'
(R):5'- ATCTTGTCAGCTATGGCCCC -3'

Sequencing Primer
(F):5'- GCAAGTGTCCTCTGGGCTTC -3'
(R):5'- AAAACGAGGCTCAGCTCTGTTTC -3'
Posted On 2018-04-27