Incidental Mutation 'R6384:Cdca3'
ID515499
Institutional Source Beutler Lab
Gene Symbol Cdca3
Ensembl Gene ENSMUSG00000023505
Gene Namecell division cycle associated 3
SynonymsTOME-1, 2410005A12Rik, Grcc8
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.422) question?
Stock #R6384 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location124829547-124833701 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 124832419 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 174 (P174L)
Ref Sequence ENSEMBL: ENSMUSP00000120626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024206] [ENSMUST00000024270] [ENSMUST00000047510] [ENSMUST00000122110] [ENSMUST00000131847] [ENSMUST00000142058] [ENSMUST00000150120] [ENSMUST00000151674] [ENSMUST00000153306]
Predicted Effect probably benign
Transcript: ENSMUST00000024206
SMART Domains Protein: ENSMUSP00000024206
Gene: ENSMUSG00000023439

DomainStartEndE-ValueType
WD40 44 83 4.91e-8 SMART
WD40 86 125 1.61e-3 SMART
WD40 132 170 5.1e-6 SMART
WD40 173 212 3.99e-8 SMART
WD40 215 254 2.67e-9 SMART
WD40 263 298 2e-1 SMART
WD40 301 340 3.87e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000024270
AA Change: P174L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect probably benign
Transcript: ENSMUST00000047510
SMART Domains Protein: ENSMUSP00000041299
Gene: ENSMUSG00000038429

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Blast:ZnF_UBP 29 78 4e-19 BLAST
ZnF_UBP 198 253 6.47e-27 SMART
low complexity region 497 516 N/A INTRINSIC
UBA 656 694 3.12e-7 SMART
UBA 724 761 8.63e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122110
SMART Domains Protein: ENSMUSP00000114000
Gene: ENSMUSG00000038429

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Blast:ZnF_UBP 29 78 4e-19 BLAST
ZnF_UBP 198 253 6.47e-27 SMART
low complexity region 497 516 N/A INTRINSIC
UBA 633 671 3.12e-7 SMART
UBA 701 738 8.63e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129251
Predicted Effect probably benign
Transcript: ENSMUST00000131847
AA Change: P174L

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134637
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136692
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140233
Predicted Effect probably benign
Transcript: ENSMUST00000142058
SMART Domains Protein: ENSMUSP00000117439
Gene: ENSMUSG00000038429

DomainStartEndE-ValueType
low complexity region 2 11 N/A INTRINSIC
Blast:ZnF_UBP 29 78 4e-20 BLAST
ZnF_UBP 180 235 6.47e-27 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000150120
AA Change: P174L

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably damaging
Transcript: ENSMUST00000151674
AA Change: P174L

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000153306
SMART Domains Protein: ENSMUSP00000118200
Gene: ENSMUSG00000038429

DomainStartEndE-ValueType
Blast:ZnF_UBP 1 32 3e-7 BLAST
ZnF_UBP 152 207 6.47e-27 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 T A 5: 121,652,003 T97S probably benign Het
Adam34 T A 8: 43,650,799 D603V probably benign Het
Adamts5 C T 16: 85,862,828 V859I probably benign Het
Alb T A 5: 90,472,640 D536E possibly damaging Het
Amz2 A G 11: 109,429,034 Y82C probably damaging Het
Asxl1 T C 2: 153,391,824 probably null Het
Bach1 C T 16: 87,719,857 Q429* probably null Het
Bcl6 A G 16: 23,974,865 Y111H probably damaging Het
Ccnj T C 19: 40,846,007 V338A probably benign Het
Cdk17 T C 10: 93,211,965 L25P probably damaging Het
Cdr2 G A 7: 120,982,128 probably null Het
Cyp2c38 A T 19: 39,392,293 probably null Het
Ednra T C 8: 77,689,094 N175D probably damaging Het
Elp3 T C 14: 65,560,211 Y337C probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Eps15l1 A T 8: 72,368,710 probably null Het
F11r A G 1: 171,460,940 N117S probably benign Het
Foxp2 C T 6: 15,437,948 T716I probably damaging Het
Gnaq A G 19: 16,316,013 probably null Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gpr158 T C 2: 21,826,288 M733T probably damaging Het
Hdac7 G A 15: 97,811,506 Q48* probably null Het
Hmga2 G A 10: 120,370,707 probably benign Het
Itgb7 A G 15: 102,224,451 V142A probably benign Het
Kif5a T C 10: 127,242,775 N334D probably damaging Het
Lrrc47 T C 4: 154,015,860 S298P probably benign Het
Map3k1 A T 13: 111,750,530 S1415R probably damaging Het
Mdn1 T A 4: 32,670,607 L424Q probably damaging Het
Numb A C 12: 83,803,974 L154R probably damaging Het
Olfr1076 A G 2: 86,509,037 K193E probably benign Het
Olfr944 T C 9: 39,217,978 V207A probably benign Het
Pdcd5 G T 7: 35,646,909 A92E possibly damaging Het
Pdcl2 C T 5: 76,331,008 probably null Het
Rbfa T C 18: 80,192,781 Y251C probably damaging Het
Rgsl1 G A 1: 153,827,545 T120I possibly damaging Het
Serpina3g A G 12: 104,240,396 Q152R probably null Het
Setx T C 2: 29,173,558 S2289P probably damaging Het
Slc6a16 A G 7: 45,257,593 probably null Het
Slco1a6 C T 6: 142,109,379 D280N probably benign Het
Syde2 T A 3: 145,998,813 Y240N probably damaging Het
Synpo2 G A 3: 123,113,049 Q873* probably null Het
Tlr2 A G 3: 83,836,994 V594A probably benign Het
Ttc16 C T 2: 32,767,549 A512T probably damaging Het
Tubb5 T C 17: 35,838,046 E3G probably damaging Het
Vmn2r112 T C 17: 22,605,155 Y464H probably damaging Het
Xcr1 T A 9: 123,855,782 H305L probably damaging Het
Yars T G 4: 129,196,978 probably null Het
Other mutations in Cdca3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02535:Cdca3 APN 6 124830558 missense probably damaging 1.00
R0206:Cdca3 UTSW 6 124832551 unclassified probably benign
R2193:Cdca3 UTSW 6 124831446 missense probably damaging 1.00
R2975:Cdca3 UTSW 6 124830653 splice site probably null
R4720:Cdca3 UTSW 6 124832164 missense probably damaging 0.97
R6275:Cdca3 UTSW 6 124832664 splice site probably null
R7376:Cdca3 UTSW 6 124832575 missense probably benign
Predicted Primers PCR Primer
(F):5'- AATCGATTTCCTCCCCAGAGC -3'
(R):5'- CCTAGAACCTTGCTGTTTGC -3'

Sequencing Primer
(F):5'- CGGGAAACGCCTTTATTTTATGACC -3'
(R):5'- AGAACCTTGCTGTTTGCTTTTCG -3'
Posted On2018-05-04