Incidental Mutation 'R6384:Gnaq'
ID515526
Institutional Source Beutler Lab
Gene Symbol Gnaq
Ensembl Gene ENSMUSG00000024639
Gene Nameguanine nucleotide binding protein, alpha q polypeptide
SynonymsGqI, Galphaq, Dsk10, G alpha q, 6230401I02Rik, Dsk1, Gq, 1110005L02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6384 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location16132831-16387463 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 16316013 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025541 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025541]
PDB Structure
Crystal Structure of G Protein-Coupled Receptor Kinase 2 in Complex with Galpha-q and Gbetagamma Subunits [X-RAY DIFFRACTION]
Crystal Structure of p63RhoGEF complex with Galpha-q and RhoA [X-RAY DIFFRACTION]
Structure of heterotrimeric G protein Galpha-q beta gamma in complex with an inhibitor YM-254890 [X-RAY DIFFRACTION]
Crystal structure of activated G alpha Q bound to its effector phospholipase C beta 3 [X-RAY DIFFRACTION]
Structure of human regulator of G protein signaling 2 (RGS2) in complex with murine Galpha-q(R183C) [X-RAY DIFFRACTION]
Structure of human regulator of G protein signaling 2 (RGS2) in complex with murine Galpha-q(R183C) [X-RAY DIFFRACTION]
Crystal structure of Galphaq in complex with full-length human PLCbeta3 [X-RAY DIFFRACTION]
Structure of a fragment of human phospholipase C-beta3 delta472-559, in complex with Galphaq [X-RAY DIFFRACTION]
Structure of a fragment of human phospholipase C-beta3 delta472-569, bound to IP3 and in complex with Galphaq [X-RAY DIFFRACTION]
Structure of a fragment of human phospholipase C-beta3 delta472-581, bound to IP3 and in complex with Galphaq [X-RAY DIFFRACTION]
Predicted Effect probably null
Transcript: ENSMUST00000025541
SMART Domains Protein: ENSMUSP00000025541
Gene: ENSMUSG00000024639

DomainStartEndE-ValueType
G_alpha 19 358 1.24e-216 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170229
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184935
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a guanine nucleotide-binding protein. The encoded protein, an alpha subunit in the Gq class, couples a seven-transmembrane domain receptor to activation of phospolipase C-beta. Mutations at this locus have been associated with problems in platelet activation and aggregation. A related pseudogene exists on chromosome 2.[provided by RefSeq, Nov 2010]
PHENOTYPE: Mutant mice exhibit pigmentation anomalies affecting the ears, tail and footpads. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad10 T A 5: 121,652,003 T97S probably benign Het
Adam34 T A 8: 43,650,799 D603V probably benign Het
Adamts5 C T 16: 85,862,828 V859I probably benign Het
Alb T A 5: 90,472,640 D536E possibly damaging Het
Amz2 A G 11: 109,429,034 Y82C probably damaging Het
Asxl1 T C 2: 153,391,824 probably null Het
Bach1 C T 16: 87,719,857 Q429* probably null Het
Bcl6 A G 16: 23,974,865 Y111H probably damaging Het
Ccnj T C 19: 40,846,007 V338A probably benign Het
Cdca3 C T 6: 124,832,419 P174L probably damaging Het
Cdk17 T C 10: 93,211,965 L25P probably damaging Het
Cdr2 G A 7: 120,982,128 probably null Het
Cyp2c38 A T 19: 39,392,293 probably null Het
Ednra T C 8: 77,689,094 N175D probably damaging Het
Elp3 T C 14: 65,560,211 Y337C probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Eps15l1 A T 8: 72,368,710 probably null Het
F11r A G 1: 171,460,940 N117S probably benign Het
Foxp2 C T 6: 15,437,948 T716I probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Gpr158 T C 2: 21,826,288 M733T probably damaging Het
Hdac7 G A 15: 97,811,506 Q48* probably null Het
Hmga2 G A 10: 120,370,707 probably benign Het
Itgb7 A G 15: 102,224,451 V142A probably benign Het
Kif5a T C 10: 127,242,775 N334D probably damaging Het
Lrrc47 T C 4: 154,015,860 S298P probably benign Het
Map3k1 A T 13: 111,750,530 S1415R probably damaging Het
Mdn1 T A 4: 32,670,607 L424Q probably damaging Het
Numb A C 12: 83,803,974 L154R probably damaging Het
Olfr1076 A G 2: 86,509,037 K193E probably benign Het
Olfr944 T C 9: 39,217,978 V207A probably benign Het
Pdcd5 G T 7: 35,646,909 A92E possibly damaging Het
Pdcl2 C T 5: 76,331,008 probably null Het
Rbfa T C 18: 80,192,781 Y251C probably damaging Het
Rgsl1 G A 1: 153,827,545 T120I possibly damaging Het
Serpina3g A G 12: 104,240,396 Q152R probably null Het
Setx T C 2: 29,173,558 S2289P probably damaging Het
Slc6a16 A G 7: 45,257,593 probably null Het
Slco1a6 C T 6: 142,109,379 D280N probably benign Het
Syde2 T A 3: 145,998,813 Y240N probably damaging Het
Synpo2 G A 3: 123,113,049 Q873* probably null Het
Tlr2 A G 3: 83,836,994 V594A probably benign Het
Ttc16 C T 2: 32,767,549 A512T probably damaging Het
Tubb5 T C 17: 35,838,046 E3G probably damaging Het
Vmn2r112 T C 17: 22,605,155 Y464H probably damaging Het
Xcr1 T A 9: 123,855,782 H305L probably damaging Het
Yars T G 4: 129,196,978 probably null Het
Other mutations in Gnaq
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01967:Gnaq APN 19 16378160 missense probably damaging 1.00
IGL02297:Gnaq APN 19 16378251 missense probably damaging 1.00
IGL02400:Gnaq APN 19 16316128 missense probably damaging 1.00
IGL03073:Gnaq APN 19 16316106 missense probably benign 0.18
R0542:Gnaq UTSW 19 16219618 missense probably damaging 0.99
R0800:Gnaq UTSW 19 16335064 missense probably damaging 1.00
R1368:Gnaq UTSW 19 16378287 missense probably benign
R1609:Gnaq UTSW 19 16383254 missense possibly damaging 0.86
R4569:Gnaq UTSW 19 16335006 missense probably damaging 1.00
R5123:Gnaq UTSW 19 16332085 missense probably benign
R5360:Gnaq UTSW 19 16133426 missense probably benign 0.01
R8251:Gnaq UTSW 19 16335055 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGGTACTCCTGCTATCTTGATG -3'
(R):5'- AAGCAGCAGCAGTCTCTCAG -3'

Sequencing Primer
(F):5'- AGCTTCAGATTTCTTTTAGAGGGG -3'
(R):5'- AGGCCTGGTGTGCAGATACTC -3'
Posted On2018-05-04