Incidental Mutation 'R6474:Tcap'
ID516742
Institutional Source Beutler Lab
Gene Symbol Tcap
Ensembl Gene ENSMUSG00000007877
Gene Nametitin-cap
SynonymsTelethonin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6474 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location98383811-98384953 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 98384177 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 46 (Q46K)
Ref Sequence ENSEMBL: ENSMUSP00000008021 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008021] [ENSMUST00000018311] [ENSMUST00000041301] [ENSMUST00000090827]
Predicted Effect probably benign
Transcript: ENSMUST00000008021
AA Change: Q46K

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000008021
Gene: ENSMUSG00000007877
AA Change: Q46K

DomainStartEndE-ValueType
Pfam:Telethonin 3 167 7.7e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000018311
SMART Domains Protein: ENSMUSP00000018311
Gene: ENSMUSG00000018167

DomainStartEndE-ValueType
low complexity region 21 34 N/A INTRINSIC
Pfam:MENTAL 48 214 1.1e-65 PFAM
START 240 445 4.43e-67 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000041218
Predicted Effect probably benign
Transcript: ENSMUST00000041301
SMART Domains Protein: ENSMUSP00000035549
Gene: ENSMUSG00000038216

DomainStartEndE-ValueType
Pfam:NNMT_PNMT_TEMT 25 290 1.2e-94 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090827
SMART Domains Protein: ENSMUSP00000088337
Gene: ENSMUSG00000038208

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:Per1 54 306 6.3e-96 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124527
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143243
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154960
Meta Mutation Damage Score 0.0782 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency 100% (35/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sarcomere assembly is regulated by the muscle protein titin. Titin is a giant elastic protein with kinase activity that extends half the length of a sarcomere. It serves as a scaffold to which myofibrils and other muscle related proteins are attached. This gene encodes a protein found in striated and cardiac muscle that binds to the titin Z1-Z2 domains and is a substrate of titin kinase, interactions thought to be critical to sarcomere assembly. Mutations in this gene are associated with limb-girdle muscular dystrophy type 2G. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit skeletal muscle atrophy, myopathy, increased muscle stiffness, and impaired coordination. Mice homozygous for another knock-out allele exhibit increased response to transverse aortic constriction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 T A 8: 71,461,715 N90Y probably damaging Het
Alkal1 T C 1: 6,389,446 V82A probably damaging Het
Ascc3 T C 10: 50,748,836 S1607P probably benign Het
Ccny A T 18: 9,345,427 L149H probably damaging Het
Clptm1 T C 7: 19,635,837 N383D possibly damaging Het
Clrn2 T A 5: 45,463,732 M156K probably benign Het
Coro2b T A 9: 62,426,628 H328L probably benign Het
Echs1 A T 7: 140,108,142 M250K probably benign Het
Ecsit A G 9: 22,074,685 V145A possibly damaging Het
Fas G A 19: 34,316,569 G108D probably damaging Het
Folh1 A G 7: 86,775,756 W2R probably damaging Het
Gba C T 3: 89,204,081 P51L probably benign Het
Grik2 C T 10: 49,132,680 M770I probably benign Het
Hcst T C 7: 30,417,825 N74S probably damaging Het
Hdac9 T A 12: 34,431,991 probably null Het
Hsfy2 T A 1: 56,636,991 D129V probably damaging Het
Htt T C 5: 34,824,895 V941A probably benign Het
Naip5 A G 13: 100,214,663 V1279A possibly damaging Het
Neb T A 2: 52,280,612 M1683L probably benign Het
Nudt21 C T 8: 94,019,654 V139I probably benign Het
Olfr513 T C 7: 108,755,029 Y58H probably damaging Het
Pex2 A G 3: 5,561,131 F206S probably damaging Het
Plek2 C A 12: 78,896,291 R77L probably benign Het
Ppfia1 A T 7: 144,506,205 D623E possibly damaging Het
Ppm1l T A 3: 69,553,041 I317N probably damaging Het
Prkacb T A 3: 146,755,724 T36S probably damaging Het
Sphkap T A 1: 83,278,823 I115F probably damaging Het
Sprtn G T 8: 124,899,134 E95* probably null Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Thada T C 17: 84,443,911 I546V possibly damaging Het
Tubal3 T A 13: 3,933,107 S296T probably benign Het
Ube3a A G 7: 59,287,024 N683D probably damaging Het
Vmn2r82 T G 10: 79,379,037 L285V possibly damaging Het
Zfp871 T C 17: 32,775,673 D157G possibly damaging Het
Other mutations in Tcap
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1845:Tcap UTSW 11 98384379 missense probably damaging 1.00
R5902:Tcap UTSW 11 98383847 start codon destroyed probably benign 0.00
R8252:Tcap UTSW 11 98384345 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTGCTACATATCAGAGTACAAGC -3'
(R):5'- TTGTGATCTCAGCCACGTCC -3'

Sequencing Primer
(F):5'- GAGTACAAGCCCCTGAAGTTTCTG -3'
(R):5'- AAGCTGGATGGGGGTCTCC -3'
Posted On2018-05-21