Incidental Mutation 'R6474:Hsfy2'
ID516718
Institutional Source Beutler Lab
Gene Symbol Hsfy2
Ensembl Gene ENSMUSG00000045336
Gene Nameheat shock transcription factor, Y-linked 2
Synonyms4933413G11Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R6474 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location56636044-56637435 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 56636991 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 129 (D129V)
Ref Sequence ENSEMBL: ENSMUSP00000049715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062085]
Predicted Effect probably damaging
Transcript: ENSMUST00000062085
AA Change: D129V

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000049715
Gene: ENSMUSG00000045336
AA Change: D129V

DomainStartEndE-ValueType
HSF 76 194 6.55e-8 SMART
low complexity region 241 246 N/A INTRINSIC
low complexity region 343 362 N/A INTRINSIC
Meta Mutation Damage Score 0.4267 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.0%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd8 T A 8: 71,461,715 N90Y probably damaging Het
Alkal1 T C 1: 6,389,446 V82A probably damaging Het
Ascc3 T C 10: 50,748,836 S1607P probably benign Het
Ccny A T 18: 9,345,427 L149H probably damaging Het
Clptm1 T C 7: 19,635,837 N383D possibly damaging Het
Clrn2 T A 5: 45,463,732 M156K probably benign Het
Coro2b T A 9: 62,426,628 H328L probably benign Het
Echs1 A T 7: 140,108,142 M250K probably benign Het
Ecsit A G 9: 22,074,685 V145A possibly damaging Het
Fas G A 19: 34,316,569 G108D probably damaging Het
Folh1 A G 7: 86,775,756 W2R probably damaging Het
Gba C T 3: 89,204,081 P51L probably benign Het
Grik2 C T 10: 49,132,680 M770I probably benign Het
Hcst T C 7: 30,417,825 N74S probably damaging Het
Hdac9 T A 12: 34,431,991 probably null Het
Htt T C 5: 34,824,895 V941A probably benign Het
Naip5 A G 13: 100,214,663 V1279A possibly damaging Het
Neb T A 2: 52,280,612 M1683L probably benign Het
Nudt21 C T 8: 94,019,654 V139I probably benign Het
Olfr513 T C 7: 108,755,029 Y58H probably damaging Het
Pex2 A G 3: 5,561,131 F206S probably damaging Het
Plek2 C A 12: 78,896,291 R77L probably benign Het
Ppfia1 A T 7: 144,506,205 D623E possibly damaging Het
Ppm1l T A 3: 69,553,041 I317N probably damaging Het
Prkacb T A 3: 146,755,724 T36S probably damaging Het
Sphkap T A 1: 83,278,823 I115F probably damaging Het
Sprtn G T 8: 124,899,134 E95* probably null Het
St3gal1 A G 15: 67,111,346 V187A possibly damaging Het
Tcap C A 11: 98,384,177 Q46K probably benign Het
Thada T C 17: 84,443,911 I546V possibly damaging Het
Tubal3 T A 13: 3,933,107 S296T probably benign Het
Ube3a A G 7: 59,287,024 N683D probably damaging Het
Vmn2r82 T G 10: 79,379,037 L285V possibly damaging Het
Zfp871 T C 17: 32,775,673 D157G possibly damaging Het
Other mutations in Hsfy2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1618:Hsfy2 UTSW 1 56637229 missense probably benign 0.41
R1670:Hsfy2 UTSW 1 56636389 missense possibly damaging 0.73
R1687:Hsfy2 UTSW 1 56636853 missense probably damaging 1.00
R1843:Hsfy2 UTSW 1 56636632 missense possibly damaging 0.84
R1954:Hsfy2 UTSW 1 56637183 missense probably benign 0.01
R2031:Hsfy2 UTSW 1 56636317 missense probably benign 0.18
R3117:Hsfy2 UTSW 1 56637106 missense probably damaging 1.00
R3778:Hsfy2 UTSW 1 56636688 missense possibly damaging 0.79
R4760:Hsfy2 UTSW 1 56637190 missense probably benign
R5065:Hsfy2 UTSW 1 56636467 nonsense probably null
R5192:Hsfy2 UTSW 1 56636735 missense probably benign 0.41
R5378:Hsfy2 UTSW 1 56636668 missense probably benign 0.41
R6296:Hsfy2 UTSW 1 56637192 missense probably benign 0.00
R6813:Hsfy2 UTSW 1 56636302 missense possibly damaging 0.86
R6996:Hsfy2 UTSW 1 56636410 missense possibly damaging 0.53
R7486:Hsfy2 UTSW 1 56636971 nonsense probably null
R7609:Hsfy2 UTSW 1 56637151 missense probably benign 0.37
R7819:Hsfy2 UTSW 1 56636259 missense probably benign
R8208:Hsfy2 UTSW 1 56637151 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGGGACAGTCTCTCAGAAAG -3'
(R):5'- CAGCGATTCTTGATAAAGAGGC -3'

Sequencing Primer
(F):5'- GGACAGTCTCTCAGAAAGTTTGG -3'
(R):5'- TTCTTGATAAAGAGGCCACCG -3'
Posted On2018-05-21