Mutagenetix > Incidental Mutations

Incidental Mutation 'R6965:Anapc4'

541937

Institutional Source

Beutler Lab

Gene Symbol

Anapc4

Ensembl Gene

ENSMUSG00000029176

Gene Name

anaphase promoting complex subunit 4

Synonyms

2610306D21Rik, D5Ertd249e, APC4

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6965 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

52834012-52867797 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 52835751 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 68 (V68A)

Ref Sequence

ENSEMBL: ENSMUSP00000031072 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031072] [ENSMUST00000144574]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000031072
AA Change: V68A

PolyPhen 2 Score 0.891 (Sensitivity: 0.82; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000031072
Gene: ENSMUSG00000029176
AA Change: V68A

Domain	Start	End	E-Value	Type
Pfam:ANAPC4_WD40	10	57	9.1e-18	PFAM
low complexity region	137	147	N/A	INTRINSIC
Pfam:ANAPC4	232	431	3.7e-61	PFAM
low complexity region	747	763	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000144574
AA Change: V68A

PolyPhen 2 Score 0.825 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000114475
Gene: ENSMUSG00000029176
AA Change: V68A

Domain	Start	End	E-Value	Type
Pfam:Apc4_WD40	10	57	4e-20	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.3%
20x: 97.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] A large protein complex, termed the anaphase-promoting complex (APC), or the cyclosome, promotes metaphase-anaphase transition by ubiquitinating its specific substrates such as mitotic cyclins and anaphase inhibitor, which are subsequently degraded by the 26S proteasome. Biochemical studies have shown that the vertebrate APC contains eight subunits. The composition of the APC is highly conserved in organisms from yeast to humans. The exact function of this gene product is not known. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca14	C	T	7: 120,283,229	Q1205*	probably null	Het
Als2	A	G	1: 59,170,557	F1422S	possibly damaging	Het
Atmin	T	C	8: 116,957,038	F479S	probably damaging	Het
Atp7b	T	C	8: 22,028,085	T234A	probably benign	Het
Bpifa1	G	A	2: 154,145,661	G144S	probably damaging	Het
Brf2	A	T	8: 27,124,558	M200K	probably benign	Het
C1ql2	G	A	1: 120,341,215	C33Y	probably damaging	Het
Cdk18	A	G	1: 132,117,581	V269A	probably damaging	Het
Clcc1	T	C	3: 108,673,309	V313A	probably damaging	Het
Cntrl	A	T	2: 35,162,833	T1117S	probably benign	Het
Col15a1	G	A	4: 47,247,533	E236K	probably damaging	Het
Comp	T	C	8: 70,376,514	L278P	probably damaging	Het
Dlg5	C	A	14: 24,149,430	D1469Y	probably damaging	Het
Efna1	A	T	3: 89,279,475	V23D	probably damaging	Het
Enpp5	G	A	17: 44,085,264	G356S	probably damaging	Het
Epb41l4b	T	C	4: 57,040,915	Y516C	probably damaging	Het
Esr2	T	C	12: 76,121,857	D526G	probably damaging	Het
Fam184b	T	C	5: 45,555,135	T514A	probably benign	Het
Fcmr	A	C	1: 130,875,987	E176A	possibly damaging	Het
Fry	T	A	5: 150,416,220	N1485K	possibly damaging	Het
Fut2	A	G	7: 45,650,881	C156R	probably damaging	Het
Gm10031	C	T	1: 156,524,549	R107*	probably null	Het
Gm5431	T	C	11: 48,895,200	Y116C	probably benign	Het
Gm5493	T	A	17: 22,748,074	V61E	possibly damaging	Het
Golga4	A	T	9: 118,548,779	Q456L	probably damaging	Het
Gpam	T	C	19: 55,074,609	Y757C	probably damaging	Het
Iqcg	C	T	16: 33,030,804	A266T	probably benign	Het
Lta4h	G	T	10: 93,471,897	G331*	probably null	Het
Macf1	C	A	4: 123,408,745	V655F	probably benign	Het
Map3k13	T	A	16: 21,922,150	D742E	probably benign	Het
Mrgprb2	G	A	7: 48,552,849	L43F	probably damaging	Het
N4bp1	T	C	8: 86,844,833	R846G	probably damaging	Het
Nbn	T	C	4: 15,970,863	I282T	probably benign	Het
Ncor1	C	T	11: 62,353,233		probably null	Het
Olfr1250	G	T	2: 89,656,665	P259T	probably damaging	Het
Olfr1426	A	G	19: 12,088,756	F12S	possibly damaging	Het
Olfr874	T	A	9: 37,746,137	M1K	probably null	Het
Pclo	A	G	5: 14,681,962		probably benign	Het
Pde9a	G	T	17: 31,443,887	V97L	probably benign	Het
Ptch1	T	C	13: 63,525,067	Y771C	possibly damaging	Het
R3hcc1l	G	A	19: 42,562,845	D94N	probably damaging	Het
Rnpep	T	A	1: 135,263,120	K602*	probably null	Het
Rph3al	T	C	11: 75,854,450	Y156C	probably damaging	Het
Rundc1	A	T	11: 101,433,911	Y481F	possibly damaging	Het
Serpinb9f	A	G	13: 33,325,876	K17R	possibly damaging	Het
Smpd3	T	C	8: 106,259,881	H459R	probably damaging	Het
Spata31	A	C	13: 64,922,834	Q932P	possibly damaging	Het
Srgap3	C	T	6: 112,723,129	A963T	probably damaging	Het
Syne1	A	T	10: 5,229,120	F4451L	possibly damaging	Het
Tbc1d19	T	A	5: 53,856,924		probably null	Het
Thap12	T	A	7: 98,715,462	V279D	probably damaging	Het
Tmprss6	T	C	15: 78,444,128	D544G	probably damaging	Het
Tox2	A	G	2: 163,323,010	*523W	probably null	Het
Txnrd1	T	C	10: 82,881,818	I212T	probably benign	Het
Unc80	T	C	1: 66,646,566	I2283T	probably benign	Het
Vmn1r176	A	G	7: 23,835,674	I18T	possibly damaging	Het
Vmn2r101	C	T	17: 19,591,022	T456I	probably benign	Het
Vmn2r79	T	A	7: 87,001,892	H166Q	probably benign	Het
Zer1	A	G	2: 30,101,047	V723A	possibly damaging	Het

Other mutations in Anapc4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00801:Anapc4	APN	5	52857211	missense	probably damaging	0.98
IGL01066:Anapc4	APN	5	52857209	missense	probably benign	0.08
IGL01109:Anapc4	APN	5	52848628	missense	probably damaging	1.00
IGL01657:Anapc4	APN	5	52864626	nonsense	probably null
IGL02692:Anapc4	APN	5	52864529	missense	probably damaging	0.98
IGL02734:Anapc4	APN	5	52861291	missense	probably benign	0.04
IGL03089:Anapc4	APN	5	52866398	missense	probably benign	0.32
IGL03096:Anapc4	APN	5	52865929	missense	possibly damaging	0.57
FR4304:Anapc4	UTSW	5	52864526	missense	probably damaging	1.00
IGL03048:Anapc4	UTSW	5	52839733	missense	probably benign	0.00
R0331:Anapc4	UTSW	5	52855642	splice site	probably benign
R0511:Anapc4	UTSW	5	52842017	unclassified	probably benign
R0624:Anapc4	UTSW	5	52845419	splice site	probably benign
R0919:Anapc4	UTSW	5	52855637	missense	probably benign	0.18
R1935:Anapc4	UTSW	5	52839668	missense	probably damaging	0.99
R1936:Anapc4	UTSW	5	52839668	missense	probably damaging	0.99
R1942:Anapc4	UTSW	5	52846714	missense	probably benign	0.30
R1953:Anapc4	UTSW	5	52839688	missense	probably damaging	1.00
R1954:Anapc4	UTSW	5	52846625	intron	probably benign
R2341:Anapc4	UTSW	5	52841937	unclassified	probably benign
R3696:Anapc4	UTSW	5	52862009	missense	probably null	0.01
R4506:Anapc4	UTSW	5	52835730	missense	possibly damaging	0.79
R4596:Anapc4	UTSW	5	52841718	missense	probably benign	0.00
R5234:Anapc4	UTSW	5	52848776	missense	probably damaging	1.00
R5256:Anapc4	UTSW	5	52863594	missense	probably benign
R5310:Anapc4	UTSW	5	52859159	missense	probably benign	0.00
R5401:Anapc4	UTSW	5	52863649	missense	probably benign	0.01
R5409:Anapc4	UTSW	5	52848599	missense	probably damaging	0.98
R5525:Anapc4	UTSW	5	52856809	missense	probably damaging	1.00
R5575:Anapc4	UTSW	5	52855871	missense	probably damaging	1.00
R5604:Anapc4	UTSW	5	52841734	nonsense	probably null
R5695:Anapc4	UTSW	5	52862239	missense	probably benign	0.00
R5955:Anapc4	UTSW	5	52865946	missense	probably benign	0.01
R5974:Anapc4	UTSW	5	52845400	missense	probably damaging	1.00
R6458:Anapc4	UTSW	5	52864553	missense	possibly damaging	0.80
R6537:Anapc4	UTSW	5	52843556	missense	probably damaging	0.98
R6633:Anapc4	UTSW	5	52865946	missense	possibly damaging	0.85
R6860:Anapc4	UTSW	5	52848828	missense	probably damaging	1.00
R7067:Anapc4	UTSW	5	52862235	missense	probably benign
R7327:Anapc4	UTSW	5	52845330	missense	probably damaging	0.99
R7442:Anapc4	UTSW	5	52857201	missense	probably benign	0.08
R7837:Anapc4	UTSW	5	52859208	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TTGGGCCTTCTGAGTTCACC -3'
(R):5'- CTGCCAACAACAGACTTTCATG -3'

Sequencing Primer
(F):5'- ATGTCTTACATTCGTTTGGACACTG -3'
(R):5'- CTGGTTTACACAAAGAGTCCTAGGC -3'

Posted On

2018-11-28