Mutagenetix > Incidental Mutation

Incidental Mutation 'R6527:Steap4'

521954

Institutional Source

Beutler Lab

Gene Symbol

Steap4

Ensembl Gene

ENSMUSG00000012428

Gene Name

STEAP family member 4

Synonyms

Tiarp, Tnfaip9

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.130) question?

Stock #

R6527 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

7960457-7982213 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 7978502 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Histidine at position 360 (L360H)

Ref Sequence

ENSEMBL: ENSMUSP00000111081 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000115421]

AlphaFold

Q923B6

Predicted Effect

probably damaging
Transcript: ENSMUST00000115421
AA Change: L360H

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000111081
Gene: ENSMUSG00000012428
AA Change: L360H

Domain	Start	End	E-Value	Type
Pfam:F420_oxidored	21	107	2.3e-16	PFAM
transmembrane domain	203	225	N/A	INTRINSIC
Pfam:Ferric_reduct	247	395	2.6e-14	PFAM
transmembrane domain	416	438	N/A	INTRINSIC

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the STEAP (six transmembrane epithelial antigen of prostate) family, and resides in the golgi apparatus. It functions as a metalloreductase that has the ability to reduce both Fe(3+) to Fe(2+) and Cu(2+) to Cu(1+), using NAD(+) as acceptor. Studies in mice and human suggest that this gene maybe involved in adipocyte development and metabolism, and may contribute to the normal biology of the prostate cell, as well as prostate cancer progression. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit adipose accumulation, oxidative stress, increased liver weight, lower metabolic rate, hypoactivity, insulin resistance, glucose intolerance, mild hyperglycemia and dyslipidemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110002E22Rik	A	G	3: 138,067,527	T826A	probably damaging	Het
Abca16	T	A	7: 120,477,772	I686N	possibly damaging	Het
Abcb6	T	C	1: 75,177,488		probably null	Het
Adgrl3	A	C	5: 81,787,517	E1299A	probably damaging	Het
Als2cr12	T	C	1: 58,692,413	M1V	probably null	Het
Amd2	A	C	10: 35,710,806	Y252D	probably damaging	Het
Cfap74	A	G	4: 155,422,265		probably null	Het
Dhx29	G	T	13: 112,932,542	K135N	probably damaging	Het
Dlg5	T	A	14: 24,190,448	D245V	possibly damaging	Het
Dscaml1	C	T	9: 45,712,184	Q83*	probably null	Het
Dsp	T	A	13: 38,195,873	L1599Q	probably damaging	Het
Duox2	A	G	2: 122,294,614	V369A	probably benign	Het
Gbe1	T	A	16: 70,433,672		probably null	Het
Gm7298	A	G	6: 121,769,710	K600R	probably benign	Het
Heatr4	C	T	12: 83,979,763	G240E	probably damaging	Het
Jakmip2	A	G	18: 43,556,524	V651A	possibly damaging	Het
Jam3	C	T	9: 27,155,344	R8Q	unknown	Het
Letm2	A	G	8: 25,592,506		probably benign	Het
Lmod3	T	C	6: 97,247,378	D494G	probably benign	Het
Mast2	T	C	4: 116,314,939	D604G	probably damaging	Het
Mif4gd	C	T	11: 115,609,275		probably null	Het
Msr1	T	C	8: 39,624,233	E112G	possibly damaging	Het
Mtus2	A	G	5: 148,277,598		probably null	Het
Muc4	A	G	16: 32,753,433	H1103R	probably benign	Het
Nudt14	T	A	12: 112,934,887	I198F	possibly damaging	Het
Olfr1341	T	A	4: 118,709,848	F147Y	possibly damaging	Het
Olfr353	T	C	2: 36,890,582	T89A	probably benign	Het
Olfr736	T	A	14: 50,393,428	L224*	probably null	Het
Osbpl8	T	C	10: 111,293,205	I884T	probably benign	Het
Podxl2	T	C	6: 88,842,930	N550S	probably damaging	Het
Ppp1r9a	A	G	6: 5,045,949	Y151C	probably damaging	Het
Prss42	T	C	9: 110,800,856	V226A	possibly damaging	Het
Psmd12	A	G	11: 107,488,968	I116V	probably damaging	Het
Psme4	A	C	11: 30,832,175	I872L	probably benign	Het
Rab11fip1	A	T	8: 27,174,392	V65E	probably damaging	Het
Ros1	T	C	10: 52,143,377	N700S	possibly damaging	Het
Slc15a4	G	A	5: 127,596,709	T547M	probably damaging	Het
Slfn3	T	A	11: 83,213,106	C268S	probably benign	Het
Smc5	T	C	19: 23,228,190	Q794R	probably benign	Het
Sqor	A	G	2: 122,809,286	Y434C	probably damaging	Het
Sycp1	A	G	3: 102,898,887	V496A	probably benign	Het
Tmem161b	T	G	13: 84,272,264	M128R	probably benign	Het
Tmem59l	T	C	8: 70,486,125	E102G	probably damaging	Het
Tnks	A	T	8: 34,873,093	V457D	probably benign	Het
Tomt	A	G	7: 101,900,392	Y230H	probably damaging	Het
Trim37	A	G	11: 87,190,084	N561D	probably damaging	Het
V1ra8	T	A	6: 90,203,313	I166K	probably damaging	Het
Vmn1r56	A	G	7: 5,196,576	V14A	probably benign	Het
Vsig8	T	C	1: 172,560,358	V5A	possibly damaging	Het
Vwa8	A	T	14: 78,947,213	S384C	possibly damaging	Het
Wwc1	C	T	11: 35,853,437	E853K	probably benign	Het
Zfp984	T	C	4: 147,755,924	N157D	probably benign	Het
Zzef1	G	A	11: 72,874,990	D1448N	probably benign	Het

Other mutations in Steap4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00596:Steap4	APN	5	7976979	missense	probably damaging	1.00
IGL00827:Steap4	APN	5	7976712	missense	probably damaging	1.00
IGL01481:Steap4	APN	5	7976858	missense	probably damaging	0.98
IGL02378:Steap4	APN	5	7976741	missense	probably benign	0.00
IGL03058:Steap4	APN	5	7975664	missense	probably benign	0.00
PIT4362001:Steap4	UTSW	5	7980337	missense	probably benign	0.03
R0329:Steap4	UTSW	5	7975829	missense	possibly damaging	0.92
R0546:Steap4	UTSW	5	7975870	missense	probably damaging	0.99
R0637:Steap4	UTSW	5	7978398	splice site	probably benign
R0638:Steap4	UTSW	5	7977030	splice site	probably benign
R0651:Steap4	UTSW	5	7980348	nonsense	probably null
R0881:Steap4	UTSW	5	7980388	missense	probably benign
R1167:Steap4	UTSW	5	7976520	missense	probably benign	0.34
R1543:Steap4	UTSW	5	7975902	splice site	probably benign
R1889:Steap4	UTSW	5	7975892	missense	probably damaging	1.00
R3803:Steap4	UTSW	5	7976979	missense	probably damaging	1.00
R3811:Steap4	UTSW	5	7977017	missense	probably benign	0.18
R3885:Steap4	UTSW	5	7980494	missense	probably damaging	1.00
R3887:Steap4	UTSW	5	7980494	missense	probably damaging	1.00
R4051:Steap4	UTSW	5	7980404	missense	probably damaging	1.00
R4208:Steap4	UTSW	5	7980404	missense	probably damaging	1.00
R5016:Steap4	UTSW	5	7976699	nonsense	probably null
R5302:Steap4	UTSW	5	7975547	nonsense	probably null
R5951:Steap4	UTSW	5	7975769	missense	probably benign	0.00
R6136:Steap4	UTSW	5	7978562	missense	probably damaging	0.99
R6631:Steap4	UTSW	5	7976995	nonsense	probably null
R6964:Steap4	UTSW	5	7975568	missense	probably damaging	1.00
R7055:Steap4	UTSW	5	7976858	missense	probably damaging	1.00
R7408:Steap4	UTSW	5	7978453	missense	probably benign	0.07
R7692:Steap4	UTSW	5	7976976	missense	probably benign	0.32
R8205:Steap4	UTSW	5	7976795	missense	possibly damaging	0.65
R8861:Steap4	UTSW	5	7975672	missense	probably benign	0.00
R9287:Steap4	UTSW	5	7976683	missense	probably benign	0.05
R9423:Steap4	UTSW	5	7976720	missense	probably damaging	0.99
R9504:Steap4	UTSW	5	7980538	missense	probably benign	0.00
R9531:Steap4	UTSW	5	7978424	missense	probably benign	0.20
R9566:Steap4	UTSW	5	7975646	missense	possibly damaging	0.51

Predicted Primers

PCR Primer
(F):5'- AGAGGTGTGTTTCAGTTCCCC -3'
(R):5'- CTGCCTGTCAGTGTCTGAGTTC -3'

Sequencing Primer
(F):5'- TCCCCTTGGAAGAGTAAAGTAGAAG -3'
(R):5'- CGAACTGCTAATGATGTGACTAG -3'

Posted On

2018-06-06